EMAIL THIS PAGE TO A FRIEND

PCBP3

poly(rC) binding protein 3

54 Gene Product Result for
Synonyms: ALPHA-CP3
Gene ID:
Human(54039) Summary: This gene encodes a member of the KH-domain protein subfamily. Proteins of this subfamily, also referred to as alpha-CPs, bind to RNA with a specificity for C-rich pyrimidine regions. Alpha-CPs play important roles in post-transcriptional activities and have different cellular distributions. This gene's protein is found in the cytoplasm, yet it lacks the nuclear localization signals found in other subfamily members. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(59093) poly(rC) binding protein 3
Rat(294336) poly(rC) binding protein 3
Zebrafish(553765) poly(rC) binding protein 3
chicken(420965) poly(rC) binding protein 3
Horse(100050101) poly(rC) binding protein 3
domestic cat(101081659) poly(rC) binding protein 3
dog(607066) poly(rC) binding protein 3
cow(613725) poly(rC) binding protein 3
sheep(101110640) poly(rC) binding protein 3
domestic guinea pig(100732628) poly(rC) binding protein 3
naked mole-rat(101707912) poly(rC) binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020528 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021568 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021568 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021568 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020528 Rosetta Predictions human pricing
NM_001011945 Rosetta Predictions rat pricing
XM_574735 Rosetta Predictions rat pricing
NM_021568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106816 predicted 1614
2 SASI_Hs01_00106817 predicted 1029
3 SASI_Hs01_00106818 predicted 801
4 SASI_Hs01_00106819 predicted 996
5 SASI_Hs01_00106820 predicted 1652
6 SASI_Hs01_00106821 predicted 1080
7 SASI_Hs01_00106822 predicted 1015
8 SASI_Hs02_00353574 predicted 380
9 SASI_Hs01_00106823 predicted 335
10 SASI_Hs01_00106824 predicted 927
11 SASI_Hs01_00106825 predicted 1533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011945 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045984 predicted 671
2 SASI_Rn01_00045985 predicted 560
3 SASI_Rn01_00045986 predicted 1209
4 SASI_Rn01_00045987 predicted 1701
5 SASI_Rn01_00045988 predicted 1364
6 SASI_Rn01_00045989 predicted 1639
7 SASI_Rn01_00045990 predicted 1658
8 SASI_Rn01_00045991 predicted 1344
9 SASI_Rn01_00045992 predicted 1512
10 SASI_Rn01_00045993 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00158948 predicted 434
2 SASI_Rn01_00158949 predicted 327
3 SASI_Rn01_00158950 predicted 1523
4 SASI_Rn01_00158951 predicted 681
5 SASI_Rn01_00158952 predicted 1192
6 SASI_Rn01_00158953 predicted 1468
7 SASI_Rn01_00158954 predicted 1482
8 SASI_Rn01_00158955 predicted 1335
9 SASI_Rn01_00158956 predicted 1181
10 SASI_Rn01_00158957 predicted 1470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090174 predicted 727
2 SASI_Mm01_00090175 predicted 617
3 SASI_Mm01_00090176 predicted 1326
4 SASI_Mm01_00090177 predicted 746
5 SASI_Mm01_00090178 predicted 690
6 SASI_Mm01_00090180 predicted 1480
7 SASI_Mm02_00326358 predicted 741
8 SASI_Mm01_00090181 predicted 1223
9 SASI_Mm01_00090182 predicted 1037
10 SASI_Mm01_00090183 predicted 1472
11 SASI_Mm01_00090179 predicted 827
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020528
PCBP3 MISSION shRNA Bacterial Glycerol Stock
poly(rC) binding protein 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020528.1-1325s1c1
Sequence:CCGGCCTGCCTCACAGATACCAATACTCGAGTATTGGTATCTGTGAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020528.1-1031s1c1
Sequence:CCGGTGATCTAATAGGCTGCATAATCTCGAGATTATGCAGCCTATTAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020528.1-1028s1c1
Sequence:CCGGCAATGATCTAATAGGCTGCATCTCGAGATGCAGCCTATTAGATCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020528.1-1178s1c1
Sequence:CCGGCCTTGCCCAGTATCTCATCAACTCGAGTTGATGAGATACTGGGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020528.1-447s1c1
Sequence:CCGGGCATACAAGTTTGAGGAGGATCTCGAGATCCTCCTCAAACTTGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020528.2-1006s21c1
Sequence:CCGGGCACTCATGAGCTCACCATTCCTCGAGGAATGGTGAGCTCATGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020528.2-934s21c1
Sequence:CCGGCTTTACACTCCTCCGAAGAAGCTCGAGCTTCTTCGGAGGAGTGTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020528
PCBP3 MISSION shRNA shRNA Plasmid DNA
poly(rC) binding protein 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020528.1-1325s1c1
Sequence:CCGGCCTGCCTCACAGATACCAATACTCGAGTATTGGTATCTGTGAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020528.1-1031s1c1
Sequence:CCGGTGATCTAATAGGCTGCATAATCTCGAGATTATGCAGCCTATTAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020528.1-1028s1c1
Sequence:CCGGCAATGATCTAATAGGCTGCATCTCGAGATGCAGCCTATTAGATCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020528.1-1178s1c1
Sequence:CCGGCCTTGCCCAGTATCTCATCAACTCGAGTTGATGAGATACTGGGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020528.1-447s1c1
Sequence:CCGGGCATACAAGTTTGAGGAGGATCTCGAGATCCTCCTCAAACTTGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020528.2-1006s21c1
Sequence:CCGGGCACTCATGAGCTCACCATTCCTCGAGGAATGGTGAGCTCATGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020528.2-934s21c1
Sequence:CCGGCTTTACACTCCTCCGAAGAAGCTCGAGCTTCTTCGGAGGAGTGTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020528
PCBP3 MISSION shRNA Lentiviral Transduction Particles
poly(rC) binding protein 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020528.1-1325s1c1
Sequence:CCGGCCTGCCTCACAGATACCAATACTCGAGTATTGGTATCTGTGAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020528.1-1031s1c1
Sequence:CCGGTGATCTAATAGGCTGCATAATCTCGAGATTATGCAGCCTATTAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020528.1-1028s1c1
Sequence:CCGGCAATGATCTAATAGGCTGCATCTCGAGATGCAGCCTATTAGATCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020528.1-1178s1c1
Sequence:CCGGCCTTGCCCAGTATCTCATCAACTCGAGTTGATGAGATACTGGGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020528.1-447s1c1
Sequence:CCGGGCATACAAGTTTGAGGAGGATCTCGAGATCCTCCTCAAACTTGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020528.2-1006s21c1
Sequence:CCGGGCACTCATGAGCTCACCATTCCTCGAGGAATGGTGAGCTCATGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020528.2-934s21c1
Sequence:CCGGCTTTACACTCCTCCGAAGAAGCTCGAGCTTCTTCGGAGGAGTGTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021568
VALIDATED
PCBP3 MISSION shRNA Bacterial Glycerol Stock
poly(rC) binding protein 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021568.1-1470s1c1
Sequence:CCGGGCAGATATGAATAGAGCGTTTCTCGAGAAACGCTCTATTCATATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021568.1-1322s1c1
Sequence:CCGGCCCAGTATCTCATCAACGCTACTCGAGTAGCGTTGATGAGATACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021568.1-1170s1c1
Sequence:CCGGTGATCTTATAGGCTGCATAATCTCGAGATTATGCAGCCTATAAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021568.1-820s1c1
Sequence:CCGGGCCATATTCCAGTGTGTGAAACTCGAGTTTCACACACTGGAATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021568.1-522s1c1
Sequence:CCGGCCCAGAGAGAATCGTTACAATCTCGAGATTGTAACGATTCTCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021568.2-752s21c1
Sequence:CCGGAGTTTGAGGAGGACATCATTACTCGAGTAATGATGTCCTCCTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021568.2-1630s21c1
Sequence:CCGGGCAGATATGAATAGAGCGTTTCTCGAGAAACGCTCTATTCATATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021568.2-1329s21c1
Sequence:CCGGTGATCTTATAGGCTGCATAATCTCGAGATTATGCAGCCTATAAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021568.2-681s21c1
Sequence:CCGGCCCAGAGAGAATCGTTACAATCTCGAGATTGTAACGATTCTCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021568
VALIDATED
PCBP3 MISSION shRNA shRNA Plasmid DNA
poly(rC) binding protein 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021568.1-1470s1c1
Sequence:CCGGGCAGATATGAATAGAGCGTTTCTCGAGAAACGCTCTATTCATATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021568.1-1322s1c1
Sequence:CCGGCCCAGTATCTCATCAACGCTACTCGAGTAGCGTTGATGAGATACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021568.1-1170s1c1
Sequence:CCGGTGATCTTATAGGCTGCATAATCTCGAGATTATGCAGCCTATAAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021568.1-820s1c1
Sequence:CCGGGCCATATTCCAGTGTGTGAAACTCGAGTTTCACACACTGGAATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021568.1-522s1c1
Sequence:CCGGCCCAGAGAGAATCGTTACAATCTCGAGATTGTAACGATTCTCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021568.2-752s21c1
Sequence:CCGGAGTTTGAGGAGGACATCATTACTCGAGTAATGATGTCCTCCTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021568.2-1630s21c1
Sequence:CCGGGCAGATATGAATAGAGCGTTTCTCGAGAAACGCTCTATTCATATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021568.2-1329s21c1
Sequence:CCGGTGATCTTATAGGCTGCATAATCTCGAGATTATGCAGCCTATAAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021568.2-681s21c1
Sequence:CCGGCCCAGAGAGAATCGTTACAATCTCGAGATTGTAACGATTCTCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021568
VALIDATED
PCBP3 MISSION shRNA Lentiviral Transduction Particles
poly(rC) binding protein 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021568.1-1470s1c1
Sequence:CCGGGCAGATATGAATAGAGCGTTTCTCGAGAAACGCTCTATTCATATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021568.1-1322s1c1
Sequence:CCGGCCCAGTATCTCATCAACGCTACTCGAGTAGCGTTGATGAGATACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021568.1-1170s1c1
Sequence:CCGGTGATCTTATAGGCTGCATAATCTCGAGATTATGCAGCCTATAAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021568.1-820s1c1
Sequence:CCGGGCCATATTCCAGTGTGTGAAACTCGAGTTTCACACACTGGAATATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021568.1-522s1c1
Sequence:CCGGCCCAGAGAGAATCGTTACAATCTCGAGATTGTAACGATTCTCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021568.2-752s21c1
Sequence:CCGGAGTTTGAGGAGGACATCATTACTCGAGTAATGATGTCCTCCTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021568.2-1630s21c1
Sequence:CCGGGCAGATATGAATAGAGCGTTTCTCGAGAAACGCTCTATTCATATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021568.2-1329s21c1
Sequence:CCGGTGATCTTATAGGCTGCATAATCTCGAGATTATGCAGCCTATAAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021568.2-681s21c1
Sequence:CCGGCCCAGAGAGAATCGTTACAATCTCGAGATTGTAACGATTCTCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)