EMAIL THIS PAGE TO A FRIEND

PCBP4

poly(rC) binding protein 4

184 Gene Product Result for
Synonyms: CBP LIP4 MCG10
UniProtKB ID: P57723, Q96AH7
Gene ID:
Human(57060) Summary: This gene encodes a member of the KH-domain protein subfamily. Proteins of this subfamily, also referred to as alpha-CPs, bind to RNA with a specificity for C-rich pyrimidine regions. Alpha-CPs play important roles in post-transcriptional activities and have different cellular distributions. This gene is induced by the p53 tumor suppressor, and the encoded protein can suppress cell proliferation by inducing apoptosis and cell cycle arrest in G(2)-M. This gene's protein is found in the cytoplasm, yet it lacks the nuclear localization signals found in other subfamily members. Multiple alternatively spliced transcript variants have been described, but the full-length nature for only some has been determined. [provided by RefSeq, Jul 2008]
Mouse(59092) poly(rC) binding protein 4
Rat(363133) poly(rC) binding protein 4
dog(476603) poly(rC) binding protein 4
domestic cat(101100287) poly(rC) binding protein 4
naked mole-rat(101699011) poly(rC) binding protein 4
Domestic Rabbit(100345078) poly(rC) binding protein 4
domestic guinea pig(100722291) poly(rC) binding protein 4
cow(506889) poly(rC) binding protein 4
sheep(101112854) poly(rC) binding protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020418 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021567 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021567 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021567 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020418 Rosetta Predictions human pricing
NM_033008 Rosetta Predictions human pricing
NM_033009 Rosetta Predictions human pricing
NM_033010 Rosetta Predictions human pricing
XM_001071111 Rosetta Predictions rat pricing
XM_343468 Rosetta Predictions rat pricing
NM_021567 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161502 predicted 1941
2 SASI_Hs01_00161503 predicted 1512
3 SASI_Hs02_00353419 predicted 2308
4 SASI_Hs01_00161504 predicted 2091
5 SASI_Hs01_00161505 predicted 1594
6 SASI_Hs01_00161506 predicted 2088
7 SASI_Hs01_00161507 predicted 2137
8 SASI_Hs01_00161509 predicted 2131
9 SASI_Hs01_00161510 predicted 2048
10 SASI_Hs02_00353420 predicted 1477
11 SASI_Hs01_00161501 predicted 1839
12 SASI_Hs01_00161508 predicted 2277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217443 predicted 1348
2 SASI_Hs01_00217444 predicted 923
3 SASI_Hs02_00360667 predicted 1722
4 SASI_Hs01_00217445 predicted 1496
5 SASI_Hs01_00217446 predicted 1008
6 SASI_Hs01_00217447 predicted 1497
7 SASI_Hs01_00217448 predicted 1543
8 SASI_Hs01_00217450 predicted 1536
9 SASI_Hs01_00217451 predicted 1456
10 SASI_Hs02_00360668 predicted 885
11 SASI_Hs01_00217442 predicted 1248
12 SASI_Hs01_00217449 predicted 1686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153862 predicted 1780
2 SASI_Hs01_00153863 predicted 1352
3 SASI_Hs02_00360669 predicted 2141
4 SASI_Hs01_00153864 predicted 1930
5 SASI_Hs01_00153865 predicted 1430
6 SASI_Hs01_00153866 predicted 1925
7 SASI_Hs01_00153867 predicted 1970
8 SASI_Hs01_00153869 predicted 1970
9 SASI_Hs01_00153870 predicted 1884
10 SASI_Hs02_00360670 predicted 1315
11 SASI_Hs01_00153861 predicted 1669
12 SASI_Hs01_00153868 predicted 2111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170970 predicted 1301
2 SASI_Hs01_00170971 predicted 875
3 SASI_Hs02_00360671 predicted 1676
4 SASI_Hs01_00170972 predicted 1451
5 SASI_Hs01_00170973 predicted 957
6 SASI_Hs01_00170974 predicted 1455
7 SASI_Hs01_00170975 predicted 1500
8 SASI_Hs01_00170977 predicted 1490
9 SASI_Hs01_00170978 predicted 1414
10 SASI_Hs02_00360672 predicted 844
11 SASI_Hs01_00170969 predicted 1198
12 SASI_Hs01_00170976 predicted 1641
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333915 predicted 1502
2 SASI_Rn02_00333916 predicted 905
3 SASI_Rn02_00333917 predicted 625
4 SASI_Rn02_00333918 predicted 1689
5 SASI_Rn02_00333919 predicted 525
6 SASI_Rn02_00333920 predicted 1232
7 SASI_Rn02_00333921 predicted 248
8 SASI_Rn02_00333922 predicted 674
9 SASI_Rn02_00333923 predicted 1008
10 SASI_Rn02_00333924 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343468 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395814 predicted 1541
2 SASI_Rn02_00395815 predicted 949
3 SASI_Rn02_00395816 predicted 662
4 SASI_Rn02_00395817 predicted 1732
5 SASI_Rn02_00395818 predicted 564
6 SASI_Rn02_00395819 predicted 1277
7 SASI_Rn02_00395820 predicted 297
8 SASI_Rn02_00395821 predicted 713
9 SASI_Rn02_00395822 predicted 1051
10 SASI_Rn02_00395823 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021567 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155063 predicted 1491
2 SASI_Mm01_00155064 predicted 284
3 SASI_Mm01_00155066 predicted 1224
4 SASI_Mm01_00155067 predicted 996
5 SASI_Mm01_00155069 predicted 958
6 SASI_Mm01_00155070 predicted 1355
7 SASI_Mm01_00155071 predicted 480
8 SASI_Mm02_00326356 predicted 657
9 SASI_Mm01_00155072 predicted 556
10 SASI_Mm02_00326357 predicted 288
11 SASI_Mm01_00155065 predicted 526
12 SASI_Mm01_00155068 predicted 1628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020418
VALIDATED
PCBP4 MISSION shRNA Bacterial Glycerol Stock
poly(rC) binding protein 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020418.2-1519s21c1
Sequence:CCGGGTTCTTGGTTCCCAACGATTTCTCGAGAAATCGTTGGGAACCAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020418.2-887s1c1
Sequence:CCGGGCTCCTGCAAATGGTGGAAATCTCGAGATTTCCACCATTTGCAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020418.2-1534s1c1
Sequence:CCGGCGATTTGATTGGCTGTGTGATCTCGAGATCACACAGCCAATCAAATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020418.2-1604s1c1
Sequence:CCGGCATATCAAGATCGGGAACCAACTCGAGTTGGTTCCCGATCTTGATATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020418.2-1868s21c1
Sequence:CCGGCCCATGCCCTTCTTGGCTTTACTCGAGTAAAGCCAAGAAGGGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020418.2-1155s1c1
Sequence:CCGGCTGTTCTCTGTTTGCAGACTACTCGAGTAGTCTGCAAACAGAGAACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020418.2-1273s1c1
Sequence:CCGGGCGCCAGATCTGCGCTGTTATCTCGAGATAACAGCGCAGATCTGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020418.2-837s21c1
Sequence:CCGGTCCATGCAGTCTCCATGATTGCTCGAGCAATCATGGAGACTGCATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020418.2-2413s21c1
Sequence:CCGGTCTTGCTGCTTCCACTGATACCTCGAGGTATCAGTGGAAGCAGCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020418.2-1222s21c1
Sequence:CCGGAGAGCGAGCTGTTACGGTATCCTCGAGGATACCGTAACAGCTCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020418
VALIDATED
PCBP4 MISSION shRNA shRNA Plasmid DNA
poly(rC) binding protein 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020418.2-1519s21c1
Sequence:CCGGGTTCTTGGTTCCCAACGATTTCTCGAGAAATCGTTGGGAACCAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020418.2-887s1c1
Sequence:CCGGGCTCCTGCAAATGGTGGAAATCTCGAGATTTCCACCATTTGCAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020418.2-1534s1c1
Sequence:CCGGCGATTTGATTGGCTGTGTGATCTCGAGATCACACAGCCAATCAAATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020418.2-1604s1c1
Sequence:CCGGCATATCAAGATCGGGAACCAACTCGAGTTGGTTCCCGATCTTGATATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020418.2-1868s21c1
Sequence:CCGGCCCATGCCCTTCTTGGCTTTACTCGAGTAAAGCCAAGAAGGGCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020418.2-1155s1c1
Sequence:CCGGCTGTTCTCTGTTTGCAGACTACTCGAGTAGTCTGCAAACAGAGAACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020418.2-1273s1c1
Sequence:CCGGGCGCCAGATCTGCGCTGTTATCTCGAGATAACAGCGCAGATCTGGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020418.2-837s21c1
Sequence:CCGGTCCATGCAGTCTCCATGATTGCTCGAGCAATCATGGAGACTGCATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020418.2-2413s21c1
Sequence:CCGGTCTTGCTGCTTCCACTGATACCTCGAGGTATCAGTGGAAGCAGCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020418.2-1222s21c1
Sequence:CCGGAGAGCGAGCTGTTACGGTATCCTCGAGGATACCGTAACAGCTCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020418
VALIDATED
PCBP4 MISSION shRNA Lentiviral Transduction Particles
poly(rC) binding protein 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020418.2-1519s21c1
Sequence:CCGGGTTCTTGGTTCCCAACGATTTCTCGAGAAATCGTTGGGAACCAAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020418.2-887s1c1
Sequence:CCGGGCTCCTGCAAATGGTGGAAATCTCGAGATTTCCACCATTTGCAGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020418.2-1534s1c1
Sequence:CCGGCGATTTGATTGGCTGTGTGATCTCGAGATCACACAGCCAATCAAATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020418.2-1604s1c1
Sequence:CCGGCATATCAAGATCGGGAACCAACTCGAGTTGGTTCCCGATCTTGATATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020418.2-1868s21c1
Sequence:CCGGCCCATGCCCTTCTTGGCTTTACTCGAGTAAAGCCAAGAAGGGCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020418.2-1155s1c1
Sequence:CCGGCTGTTCTCTGTTTGCAGACTACTCGAGTAGTCTGCAAACAGAGAACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020418.2-1273s1c1
Sequence:CCGGGCGCCAGATCTGCGCTGTTATCTCGAGATAACAGCGCAGATCTGGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020418.2-837s21c1
Sequence:CCGGTCCATGCAGTCTCCATGATTGCTCGAGCAATCATGGAGACTGCATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020418.2-2413s21c1
Sequence:CCGGTCTTGCTGCTTCCACTGATACCTCGAGGTATCAGTGGAAGCAGCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020418.2-1222s21c1
Sequence:CCGGAGAGCGAGCTGTTACGGTATCCTCGAGGATACCGTAACAGCTCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021567
VALIDATED
PCBP4 MISSION shRNA Bacterial Glycerol Stock
poly(rC) binding protein 4
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021567.2-1004s1c1
Sequence:CCGGCATATTAAGATCGGGAACCAACTCGAGTTGGTTCCCGATCTTAATATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021567.2-1801s1c1
Sequence:CCGGGCTGCTTCTACTGATACCCTTCTCGAGAAGGGTATCAGTAGAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021567.2-914s1c1
Sequence:CCGGCAGGAGTTTCTGGTTCCCAATCTCGAGATTGGGAACCAGAAACTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021567.2-917s1c1
Sequence:CCGGGAGTTTCTGGTTCCCAATGATCTCGAGATCATTGGGAACCAGAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021567.2-1362s1c1
Sequence:CCGGAGAAAGCTGAACGGCAGAAATCTCGAGATTTCTGCCGTTCAGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021567.4-1828s21c1
Sequence:CCGGTCCTGCTGCTTCTACTGATACCTCGAGGTATCAGTAGAAGCAGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021567.4-1653s21c1
Sequence:CCGGACCTCTACAGACCTATGCTTGCTCGAGCAAGCATAGGTCTGTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021567.4-948s21c1
Sequence:CCGGGAGTTTCTGGTTCCCAATGATCTCGAGATCATTGGGAACCAGAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021567.4-1393s21c1
Sequence:CCGGAGAAAGCTGAACGGCAGAAATCTCGAGATTTCTGCCGTTCAGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021567.4-295s21c1
Sequence:CCGGAGGAAGTGGGCAGCATCATTGCTCGAGCAATGATGCTGCCCACTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021567.4-317s21c1
Sequence:CCGGGAAGAAGGGAGAGACTGTAAACTCGAGTTTACAGTCTCTCCCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021567
VALIDATED
PCBP4 MISSION shRNA shRNA Plasmid DNA
poly(rC) binding protein 4
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021567.2-1004s1c1
Sequence:CCGGCATATTAAGATCGGGAACCAACTCGAGTTGGTTCCCGATCTTAATATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021567.2-1801s1c1
Sequence:CCGGGCTGCTTCTACTGATACCCTTCTCGAGAAGGGTATCAGTAGAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021567.2-914s1c1
Sequence:CCGGCAGGAGTTTCTGGTTCCCAATCTCGAGATTGGGAACCAGAAACTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021567.2-917s1c1
Sequence:CCGGGAGTTTCTGGTTCCCAATGATCTCGAGATCATTGGGAACCAGAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021567.2-1362s1c1
Sequence:CCGGAGAAAGCTGAACGGCAGAAATCTCGAGATTTCTGCCGTTCAGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021567.4-1828s21c1
Sequence:CCGGTCCTGCTGCTTCTACTGATACCTCGAGGTATCAGTAGAAGCAGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021567.4-1653s21c1
Sequence:CCGGACCTCTACAGACCTATGCTTGCTCGAGCAAGCATAGGTCTGTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021567.4-948s21c1
Sequence:CCGGGAGTTTCTGGTTCCCAATGATCTCGAGATCATTGGGAACCAGAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021567.4-1393s21c1
Sequence:CCGGAGAAAGCTGAACGGCAGAAATCTCGAGATTTCTGCCGTTCAGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021567.4-295s21c1
Sequence:CCGGAGGAAGTGGGCAGCATCATTGCTCGAGCAATGATGCTGCCCACTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021567.4-317s21c1
Sequence:CCGGGAAGAAGGGAGAGACTGTAAACTCGAGTTTACAGTCTCTCCCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021567
VALIDATED
PCBP4 MISSION shRNA Lentiviral Transduction Particles
poly(rC) binding protein 4
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021567.2-1004s1c1
Sequence:CCGGCATATTAAGATCGGGAACCAACTCGAGTTGGTTCCCGATCTTAATATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021567.2-1801s1c1
Sequence:CCGGGCTGCTTCTACTGATACCCTTCTCGAGAAGGGTATCAGTAGAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021567.2-914s1c1
Sequence:CCGGCAGGAGTTTCTGGTTCCCAATCTCGAGATTGGGAACCAGAAACTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021567.2-917s1c1
Sequence:CCGGGAGTTTCTGGTTCCCAATGATCTCGAGATCATTGGGAACCAGAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021567.2-1362s1c1
Sequence:CCGGAGAAAGCTGAACGGCAGAAATCTCGAGATTTCTGCCGTTCAGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021567.4-1828s21c1
Sequence:CCGGTCCTGCTGCTTCTACTGATACCTCGAGGTATCAGTAGAAGCAGCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021567.4-1653s21c1
Sequence:CCGGACCTCTACAGACCTATGCTTGCTCGAGCAAGCATAGGTCTGTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021567.4-948s21c1
Sequence:CCGGGAGTTTCTGGTTCCCAATGATCTCGAGATCATTGGGAACCAGAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021567.4-1393s21c1
Sequence:CCGGAGAAAGCTGAACGGCAGAAATCTCGAGATTTCTGCCGTTCAGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021567.4-295s21c1
Sequence:CCGGAGGAAGTGGGCAGCATCATTGCTCGAGCAATGATGCTGCCCACTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021567.4-317s21c1
Sequence:CCGGGAAGAAGGGAGAGACTGTAAACTCGAGTTTACAGTCTCTCCCTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)