EMAIL THIS PAGE TO A FRIEND

PCCA

propionyl CoA carboxylase, alpha polypeptide

107 Gene Product Result for
UniProtKB ID: P05165, B4DKY8, B4DPF9, C9JPQ8, Q15979, Q8WXQ7
Gene ID:
Human(5095) Summary: The protein encoded by this gene is the alpha subunit of the heterodimeric mitochondrial enzyme Propionyl-CoA carboxylase. PCCA encodes the biotin-binding region of this enzyme. Mutations in either PCCA or PCCB (encoding the beta subunit) lead to an enzyme deficiency resulting in propionic acidemia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
Mouse(110821) propionyl-Coenzyme A carboxylase, alpha polypeptide
Rat(687008) propionyl CoA carboxylase, alpha polypeptide
Zebrafish(437019) propionyl-Coenzyme A carboxylase, alpha polypeptide
chicken(418774) propionyl CoA carboxylase, alpha polypeptide
dog(476975) propionyl CoA carboxylase, alpha polypeptide
domestic cat(101080758) propionyl CoA carboxylase, alpha polypeptide
cow(614302) propionyl CoA carboxylase, alpha polypeptide
sheep(101112991) propionyl CoA carboxylase, alpha polypeptide
domestic guinea pig(100722933) propionyl CoA carboxylase, alpha polypeptide
naked mole-rat(101711474) propionyl CoA carboxylase, alpha polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000282 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144844 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144844 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144844 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000282 Rosetta Predictions human pricing
NM_001127692 Rosetta Predictions human pricing
NM_019330 Rosetta Predictions rat pricing
NM_144844 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149085 predicted 1529
2 SASI_Hs02_00302238 predicted 1332
3 SASI_Hs02_00302239 predicted 797
4 SASI_Hs01_00149086 predicted 1604
5 SASI_Hs01_00149088 predicted 278
6 SASI_Hs01_00149089 predicted 1757
7 SASI_Hs01_00149090 predicted 1287
8 SASI_Hs01_00149091 predicted 614
9 SASI_Hs01_00149092 predicted 1439
10 SASI_Hs01_00149093 predicted 1925
11 SASI_Hs01_00149087 predicted 1533
12 SASI_Hs01_00149094 predicted 1504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330144 predicted 1458
2 SASI_Hs02_00330145 predicted 1252
3 SASI_Hs02_00330146 predicted 715
4 SASI_Hs02_00330147 predicted 1521
5 SASI_Hs02_00330148 predicted 202
6 SASI_Hs02_00330149 predicted 1683
7 SASI_Hs02_00330150 predicted 1206
8 SASI_Hs02_00330151 predicted 533
9 SASI_Hs02_00330152 predicted 1362
10 SASI_Hs02_00330153 predicted 1853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262299 predicted 228
2 SASI_Rn02_00262300 predicted 506
3 SASI_Rn02_00262301 predicted 1473
4 SASI_Rn02_00262302 predicted 1243
5 SASI_Rn02_00262303 predicted 1122
6 SASI_Rn02_00262304 predicted 1339
7 SASI_Rn02_00262305 predicted 1751
8 SASI_Rn02_00262306 predicted 386
9 SASI_Rn02_00262307 predicted 2066
10 SASI_Rn02_00262308 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196470 predicted 1134
2 SASI_Mm01_00196471 predicted 1548
3 SASI_Mm02_00340243 predicted 1342
4 SASI_Mm02_00340244 predicted 1590
5 SASI_Mm01_00196472 predicted 280
6 SASI_Mm01_00196473 predicted 2078
7 SASI_Mm01_00196474 predicted 1764
8 SASI_Mm01_00196475 predicted 1243
9 SASI_Mm01_00196476 predicted 1690
10 SASI_Mm01_00196477 predicted 1758
11 SASI_Mm01_00196469 predicted 1522
12 SASI_Mm01_00196478 predicted 1512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000282
VALIDATED
PCCA MISSION shRNA Bacterial Glycerol Stock
propionyl CoA carboxylase, alpha polypeptide
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000282.2-1487s21c1
Sequence:CCGGATTACTTCGAGAGGTGATAATCTCGAGATTATCACCTCTCGAAGTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000282.2-2278s21c1
Sequence:CCGGGCTTTCACACACAATTGATTCCTCGAGGAATCAATTGTGTGTGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000282.1-775s1c1
Sequence:CCGGCGTCATATAGAAATCCAGGTTCTCGAGAACCTGGATTTCTATATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000282.1-1156s1c1
Sequence:CCGGGCAGTTGAATGTCGGGTTTATCTCGAGATAAACCCGACATTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000282.1-497s1c1
Sequence:CCGGGCGACAAGATTGAAAGCAAATCTCGAGATTTGCTTTCAATCTTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000282.1-1282s1c1
Sequence:CCGGCCAGGAAGTGATATTAGCATTCTCGAGAATGCTAATATCACTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_000282.1-1834s1c1
Sequence:CCGGGCAGGTGGAAACATGAGCATTCTCGAGAATGCTCATGTTTCCACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000282
VALIDATED
PCCA MISSION shRNA shRNA Plasmid DNA
propionyl CoA carboxylase, alpha polypeptide
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000282.2-1487s21c1
Sequence:CCGGATTACTTCGAGAGGTGATAATCTCGAGATTATCACCTCTCGAAGTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000282.2-2278s21c1
Sequence:CCGGGCTTTCACACACAATTGATTCCTCGAGGAATCAATTGTGTGTGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000282.1-775s1c1
Sequence:CCGGCGTCATATAGAAATCCAGGTTCTCGAGAACCTGGATTTCTATATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000282.1-1156s1c1
Sequence:CCGGGCAGTTGAATGTCGGGTTTATCTCGAGATAAACCCGACATTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000282.1-497s1c1
Sequence:CCGGGCGACAAGATTGAAAGCAAATCTCGAGATTTGCTTTCAATCTTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000282.1-1282s1c1
Sequence:CCGGCCAGGAAGTGATATTAGCATTCTCGAGAATGCTAATATCACTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_000282.1-1834s1c1
Sequence:CCGGGCAGGTGGAAACATGAGCATTCTCGAGAATGCTCATGTTTCCACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000282
VALIDATED
PCCA MISSION shRNA Lentiviral Transduction Particles
propionyl CoA carboxylase, alpha polypeptide
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000282.2-1487s21c1
Sequence:CCGGATTACTTCGAGAGGTGATAATCTCGAGATTATCACCTCTCGAAGTAATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000282.2-2278s21c1
Sequence:CCGGGCTTTCACACACAATTGATTCCTCGAGGAATCAATTGTGTGTGAAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000282.1-775s1c1
Sequence:CCGGCGTCATATAGAAATCCAGGTTCTCGAGAACCTGGATTTCTATATGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000282.1-1156s1c1
Sequence:CCGGGCAGTTGAATGTCGGGTTTATCTCGAGATAAACCCGACATTCAACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000282.1-497s1c1
Sequence:CCGGGCGACAAGATTGAAAGCAAATCTCGAGATTTGCTTTCAATCTTGTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000282.1-1282s1c1
Sequence:CCGGCCAGGAAGTGATATTAGCATTCTCGAGAATGCTAATATCACTTCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_000282.1-1834s1c1
Sequence:CCGGGCAGGTGGAAACATGAGCATTCTCGAGAATGCTCATGTTTCCACCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144844
VALIDATED
PCCA MISSION shRNA Bacterial Glycerol Stock
propionyl CoA carboxylase, alpha polypeptide
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144844.1-814s21c1
Sequence:CCGGATCGATAACCCTCGTCATATACTCGAGTATATGACGAGGGTTATCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144844.2-1664s21c1
Sequence:CCGGATTCAAGAGTACCAGTTATTACTCGAGTAATAACTGGTACTCTTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144844.2-1210s21c1
Sequence:CCGGGCAGTTGAATGTCGGGTTTATCTCGAGATAAACCCGACATTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144844.1-1339s21c1
Sequence:CCGGAGTGACATCAGCATCTATTATCTCGAGATAATAGATGCTGATGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144844.1-2330s1c1
Sequence:CCGGCCTCCTGTTTATTCCTCAGAACTCGAGTTCTGAGGAATAAACAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144844.1-1121s1c1
Sequence:CCGGGCCTGGACTTAGTCCAAGAAACTCGAGTTTCTTGGACTAAGTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144844.1-505s1c1
Sequence:CCGGGTCACTTTCATTGGACCTGATCTCGAGATCAGGTCCAATGAAAGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144844.1-1237s1c1
Sequence:CCGGCCCTACAAGTCTTTCGGTTTACTCGAGTAAACCGAAAGACTTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144844.2-818s21c1
Sequence:CCGGTCGATAACCCTCGTCATATAGCTCGAGCTATATGACGAGGGTTATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144844.1-2330s21c1
Sequence:CCGGCCTCCTGTTTATTCCTCAGAACTCGAGTTCTGAGGAATAAACAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144844.1-1659s21c1
Sequence:CCGGACGTTCAAGAGTACCAGTTATCTCGAGATAACTGGTACTCTTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144844.1-505s21c1
Sequence:CCGGGTCACTTTCATTGGACCTGATCTCGAGATCAGGTCCAATGAAAGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144844.1-1787s1c1
Sequence:CCGGCGAAACTAAATGTGACCAGTACTCGAGTACTGGTCACATTTAGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144844
VALIDATED
PCCA MISSION shRNA shRNA Plasmid DNA
propionyl CoA carboxylase, alpha polypeptide
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144844.1-814s21c1
Sequence:CCGGATCGATAACCCTCGTCATATACTCGAGTATATGACGAGGGTTATCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144844.2-1664s21c1
Sequence:CCGGATTCAAGAGTACCAGTTATTACTCGAGTAATAACTGGTACTCTTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144844.2-1210s21c1
Sequence:CCGGGCAGTTGAATGTCGGGTTTATCTCGAGATAAACCCGACATTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144844.1-1339s21c1
Sequence:CCGGAGTGACATCAGCATCTATTATCTCGAGATAATAGATGCTGATGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144844.1-2330s1c1
Sequence:CCGGCCTCCTGTTTATTCCTCAGAACTCGAGTTCTGAGGAATAAACAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144844.1-1121s1c1
Sequence:CCGGGCCTGGACTTAGTCCAAGAAACTCGAGTTTCTTGGACTAAGTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144844.1-505s1c1
Sequence:CCGGGTCACTTTCATTGGACCTGATCTCGAGATCAGGTCCAATGAAAGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144844.1-1237s1c1
Sequence:CCGGCCCTACAAGTCTTTCGGTTTACTCGAGTAAACCGAAAGACTTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144844.2-818s21c1
Sequence:CCGGTCGATAACCCTCGTCATATAGCTCGAGCTATATGACGAGGGTTATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144844.1-2330s21c1
Sequence:CCGGCCTCCTGTTTATTCCTCAGAACTCGAGTTCTGAGGAATAAACAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144844.1-1659s21c1
Sequence:CCGGACGTTCAAGAGTACCAGTTATCTCGAGATAACTGGTACTCTTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144844.1-505s21c1
Sequence:CCGGGTCACTTTCATTGGACCTGATCTCGAGATCAGGTCCAATGAAAGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144844.1-1787s1c1
Sequence:CCGGCGAAACTAAATGTGACCAGTACTCGAGTACTGGTCACATTTAGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144844
VALIDATED
PCCA MISSION shRNA Lentiviral Transduction Particles
propionyl CoA carboxylase, alpha polypeptide
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144844.1-814s21c1
Sequence:CCGGATCGATAACCCTCGTCATATACTCGAGTATATGACGAGGGTTATCGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144844.2-1664s21c1
Sequence:CCGGATTCAAGAGTACCAGTTATTACTCGAGTAATAACTGGTACTCTTGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144844.2-1210s21c1
Sequence:CCGGGCAGTTGAATGTCGGGTTTATCTCGAGATAAACCCGACATTCAACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144844.1-1339s21c1
Sequence:CCGGAGTGACATCAGCATCTATTATCTCGAGATAATAGATGCTGATGTCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144844.1-2330s1c1
Sequence:CCGGCCTCCTGTTTATTCCTCAGAACTCGAGTTCTGAGGAATAAACAGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144844.1-1121s1c1
Sequence:CCGGGCCTGGACTTAGTCCAAGAAACTCGAGTTTCTTGGACTAAGTCCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144844.1-505s1c1
Sequence:CCGGGTCACTTTCATTGGACCTGATCTCGAGATCAGGTCCAATGAAAGTGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144844.1-1237s1c1
Sequence:CCGGCCCTACAAGTCTTTCGGTTTACTCGAGTAAACCGAAAGACTTGTAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144844.2-818s21c1
Sequence:CCGGTCGATAACCCTCGTCATATAGCTCGAGCTATATGACGAGGGTTATCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144844.1-2330s21c1
Sequence:CCGGCCTCCTGTTTATTCCTCAGAACTCGAGTTCTGAGGAATAAACAGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144844.1-1659s21c1
Sequence:CCGGACGTTCAAGAGTACCAGTTATCTCGAGATAACTGGTACTCTTGAACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144844.1-505s21c1
Sequence:CCGGGTCACTTTCATTGGACCTGATCTCGAGATCAGGTCCAATGAAAGTGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144844.1-1787s1c1
Sequence:CCGGCGAAACTAAATGTGACCAGTACTCGAGTACTGGTCACATTTAGTTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)