EMAIL THIS PAGE TO A FRIEND

PCCB

propionyl CoA carboxylase, beta polypeptide

133 Gene Product Result for
UniProtKB ID: P05166, B7Z2Z4, Q16813, Q96CX0
Gene ID:
Human(5096) Summary: The protein encoded by this gene is a subunit of the propionyl-CoA carboxylase (PCC) enzyme, which is involved in the catabolism of propionyl-CoA. PCC is a mitochondrial enzyme that probably acts as a dodecamer of six alpha subunits and six beta subunits. This gene encodes the beta subunit of PCC. Defects in this gene are a cause of propionic acidemia type II (PA-2). Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
Mouse(66904) propionyl Coenzyme A carboxylase, beta polypeptide
Rat(24624) propionyl CoA carboxylase, beta polypeptide
cow(515902) propionyl CoA carboxylase, beta polypeptide
sheep(101113555) propionyl CoA carboxylase, beta polypeptide
naked mole-rat(101699369) propionyl CoA carboxylase, beta polypeptide
domestic guinea pig(100729570) propionyl CoA carboxylase, beta polypeptide
Zebrafish(405861) propionyl Coenzyme A carboxylase, beta polypeptide
Horse(100065950) propionyl CoA carboxylase, beta polypeptide
domestic cat(101082847) propionyl CoA carboxylase, beta polypeptide
dog(477076) propionyl CoA carboxylase, beta polypeptide
chicken(768706) propionyl CoA carboxylase, beta polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025835 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025835 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025835 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000532 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000532 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000532 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042161 MISSION® esiRNA esiRNA human PCCB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000532 Rosetta Predictions human pricing
NM_017030 Rosetta Predictions rat pricing
NM_025835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302743 predicted 733
2 SASI_Hs01_00164386 predicted 677
3 SASI_Hs01_00164387 predicted 1295
4 SASI_Hs01_00164388 predicted 1330
5 SASI_Hs02_00302744 predicted 508
6 SASI_Hs01_00164390 predicted 1236
7 SASI_Hs01_00164391 predicted 1372
8 SASI_Hs01_00164392 predicted 839
9 SASI_Hs02_00302745 predicted 1193
10 SASI_Hs01_00164393 predicted 387
11 SASI_Hs01_00164389 predicted 536
12 SASI_Hs01_00164394 predicted 974
13 SASI_Hs01_00164395 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099654 predicted 955
2 SASI_Rn01_00099653 predicted 1109
3 SASI_Rn01_00099655 predicted 1294
4 SASI_Rn01_00099656 predicted 1552
5 SASI_Rn01_00099657 predicted 1534
6 SASI_Rn01_00099660 predicted 1342
7 SASI_Rn01_00099661 predicted 576
8 SASI_Rn01_00099659 predicted 351
9 SASI_Rn02_00261206 predicted 955
10 SASI_Rn02_00261207 predicted 639
11 SASI_Rn01_00099658 predicted 1700
12 SASI_Rn01_00099662 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166761 predicted 1548
2 SASI_Mm01_00166763 predicted 1560
3 SASI_Mm01_00166764 predicted 479
4 SASI_Mm02_00329110 predicted 676
5 SASI_Mm02_00329111 predicted 697
6 SASI_Mm01_00166765 predicted 785
7 SASI_Mm02_00329112 predicted 685
8 SASI_Mm01_00166766 predicted 370
9 SASI_Mm01_00166767 predicted 720
10 SASI_Mm01_00166768 predicted 1651
11 SASI_Mm01_00166762 predicted 1121
12 SASI_Mm01_00166769 predicted 1359
13 SASI_Mm01_00166770 predicted 1734
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025835
VALIDATED
PCCB MISSION shRNA Bacterial Glycerol Stock
propionyl CoA carboxylase, beta polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025835.1-2095s1c1
Sequence:CCGGGCTATGTGATGTCTCGATATTCTCGAGAATATCGAGACATCACATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025835.1-707s1c1
Sequence:CCGGCCTGAAGTTGTGAAGTCTGTTCTCGAGAACAGACTTCACAACTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025835.1-311s1c1
Sequence:CCGGGCTGCTGATAAGAATAAGTTTCTCGAGAAACTTATTCTTATCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025835.1-595s1c1
Sequence:CCGGCCCGCAGATTTCTCTGATCATCTCGAGATGATCAGAGAAATCTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025835.1-363s1c1
Sequence:CCGGGAATCAATGGACGATTGGTTTCTCGAGAAACCAATCGTCCATTGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025835
VALIDATED
PCCB MISSION shRNA shRNA Plasmid DNA
propionyl CoA carboxylase, beta polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025835.1-2095s1c1
Sequence:CCGGGCTATGTGATGTCTCGATATTCTCGAGAATATCGAGACATCACATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025835.1-707s1c1
Sequence:CCGGCCTGAAGTTGTGAAGTCTGTTCTCGAGAACAGACTTCACAACTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025835.1-311s1c1
Sequence:CCGGGCTGCTGATAAGAATAAGTTTCTCGAGAAACTTATTCTTATCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025835.1-595s1c1
Sequence:CCGGCCCGCAGATTTCTCTGATCATCTCGAGATGATCAGAGAAATCTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025835.1-363s1c1
Sequence:CCGGGAATCAATGGACGATTGGTTTCTCGAGAAACCAATCGTCCATTGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025835
VALIDATED
PCCB MISSION shRNA Lentiviral Transduction Particles
propionyl CoA carboxylase, beta polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025835.1-2095s1c1
Sequence:CCGGGCTATGTGATGTCTCGATATTCTCGAGAATATCGAGACATCACATAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025835.1-707s1c1
Sequence:CCGGCCTGAAGTTGTGAAGTCTGTTCTCGAGAACAGACTTCACAACTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025835.1-311s1c1
Sequence:CCGGGCTGCTGATAAGAATAAGTTTCTCGAGAAACTTATTCTTATCAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025835.1-595s1c1
Sequence:CCGGCCCGCAGATTTCTCTGATCATCTCGAGATGATCAGAGAAATCTGCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025835.1-363s1c1
Sequence:CCGGGAATCAATGGACGATTGGTTTCTCGAGAAACCAATCGTCCATTGATTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000532
VALIDATED
PCCB MISSION shRNA Bacterial Glycerol Stock
propionyl CoA carboxylase, beta polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000532.3-580s21c1
Sequence:CCGGGCAGACATCTTTCTGAGGAATCTCGAGATTCCTCAGAAAGATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000532.3-1501s21c1
Sequence:CCGGGCAGAGTACATCGAGAAGTTTCTCGAGAAACTTCTCGATGTACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000532.2-870s1c1
Sequence:CCGGCCTTGTGTAATCTCCGGGATTCTCGAGAATCCCGGAGATTACACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000532.2-1520s1c1
Sequence:CCGGGCAGAGTACATCGAGAAGTTTCTCGAGAAACTTCTCGATGTACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000532.2-1019s1c1
Sequence:CCGGGTGGACATCATACACTCTGTTCTCGAGAACAGAGTGTATGATGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_000532.2-599s1c1
Sequence:CCGGGCAGACATCTTTCTGAGGAATCTCGAGATTCCTCAGAAAGATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_000532.2-1069s1c1
Sequence:CCGGGCCCAATTATGCCAAGAACATCTCGAGATGTTCTTGGCATAATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000532.3-1136s21c1
Sequence:CCGGCCTCAGGATGCTTGGATATTACTCGAGTAATATCCAAGCATCCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000532.3-851s21c1
Sequence:CCGGCCTTGTGTAATCTCCGGGATTCTCGAGAATCCCGGAGATTACACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000532
VALIDATED
PCCB MISSION shRNA shRNA Plasmid DNA
propionyl CoA carboxylase, beta polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000532.3-580s21c1
Sequence:CCGGGCAGACATCTTTCTGAGGAATCTCGAGATTCCTCAGAAAGATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000532.3-1501s21c1
Sequence:CCGGGCAGAGTACATCGAGAAGTTTCTCGAGAAACTTCTCGATGTACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000532.2-870s1c1
Sequence:CCGGCCTTGTGTAATCTCCGGGATTCTCGAGAATCCCGGAGATTACACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000532.2-1520s1c1
Sequence:CCGGGCAGAGTACATCGAGAAGTTTCTCGAGAAACTTCTCGATGTACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000532.2-1019s1c1
Sequence:CCGGGTGGACATCATACACTCTGTTCTCGAGAACAGAGTGTATGATGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_000532.2-599s1c1
Sequence:CCGGGCAGACATCTTTCTGAGGAATCTCGAGATTCCTCAGAAAGATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_000532.2-1069s1c1
Sequence:CCGGGCCCAATTATGCCAAGAACATCTCGAGATGTTCTTGGCATAATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000532.3-1136s21c1
Sequence:CCGGCCTCAGGATGCTTGGATATTACTCGAGTAATATCCAAGCATCCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000532.3-851s21c1
Sequence:CCGGCCTTGTGTAATCTCCGGGATTCTCGAGAATCCCGGAGATTACACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000532
VALIDATED
PCCB MISSION shRNA Lentiviral Transduction Particles
propionyl CoA carboxylase, beta polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000532.3-580s21c1
Sequence:CCGGGCAGACATCTTTCTGAGGAATCTCGAGATTCCTCAGAAAGATGTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000532.3-1501s21c1
Sequence:CCGGGCAGAGTACATCGAGAAGTTTCTCGAGAAACTTCTCGATGTACTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000532.2-870s1c1
Sequence:CCGGCCTTGTGTAATCTCCGGGATTCTCGAGAATCCCGGAGATTACACAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000532.2-1520s1c1
Sequence:CCGGGCAGAGTACATCGAGAAGTTTCTCGAGAAACTTCTCGATGTACTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000532.2-1019s1c1
Sequence:CCGGGTGGACATCATACACTCTGTTCTCGAGAACAGAGTGTATGATGTCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_000532.2-599s1c1
Sequence:CCGGGCAGACATCTTTCTGAGGAATCTCGAGATTCCTCAGAAAGATGTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_000532.2-1069s1c1
Sequence:CCGGGCCCAATTATGCCAAGAACATCTCGAGATGTTCTTGGCATAATTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000532.3-1136s21c1
Sequence:CCGGCCTCAGGATGCTTGGATATTACTCGAGTAATATCCAAGCATCCTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000532.3-851s21c1
Sequence:CCGGCCTTGTGTAATCTCCGGGATTCTCGAGAATCCCGGAGATTACACAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)