EMAIL THIS PAGE TO A FRIEND

PCDH10

protocadherin 10

411 Gene Product Result for
Synonyms: OL-PCDH PCDH19
UniProtKB ID: Q9P2E7, Q4W5F6
Gene ID:
Human(57575) Summary: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The mRNA encodes a cadherin-related neuronal receptor thought to play a role in the establishment and function of specific cell-cell connections in the brain. This family member contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Alternatively spliced transcripts encode isoforms with unique cytoplasmic domains. [provided by RefSeq, Jul 2008]
Mouse(18526) protocadherin 10
Rat(361943) protocadherin 10
Zebrafish(100006777) protocadherin 10
chicken(408048) protocadherin 10
Domestic Rabbit(100339837) protocadherin 10
naked mole-rat(101705691) protocadherin 10
cow(531875) protocadherin 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011043 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011043 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011043 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020815 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010251 MISSION® esiRNA esiRNA targeting human PCDH10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020815 Rosetta Predictions human pricing
NM_032961 Rosetta Predictions human pricing
XM_001054521 Rosetta Predictions rat pricing
XM_342242 Rosetta Predictions rat pricing
NM_001098170 Rosetta Predictions mouse pricing
NM_001098171 Rosetta Predictions mouse pricing
NM_001098172 Rosetta Predictions mouse pricing
NM_011043 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159353 predicted 1191
2 SASI_Hs01_00159355 predicted 2479
3 SASI_Hs01_00159356 predicted 2489
4 SASI_Hs01_00159357 predicted 2171
5 SASI_Hs01_00159358 predicted 2031
6 SASI_Hs02_00354012 predicted 2351
7 SASI_Hs01_00159359 predicted 2225
8 SASI_Hs01_00159360 predicted 2159
9 SASI_Hs01_00159361 predicted 3195
10 SASI_Hs01_00159362 predicted 1067
11 SASI_Hs01_00159354 predicted 2426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079230 predicted 1195
2 SASI_Hs01_00079232 predicted 2483
3 SASI_Hs01_00079233 predicted 2488
4 SASI_Hs01_00079234 predicted 2171
5 SASI_Hs01_00079235 predicted 2032
6 SASI_Hs02_00360582 predicted 2358
7 SASI_Hs01_00079236 predicted 2230
8 SASI_Hs01_00079237 predicted 2156
9 SASI_Hs01_00079238 predicted 3197
10 SASI_Hs01_00079239 predicted 1062
11 SASI_Hs01_00079231 predicted 2426
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054521 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276118 predicted 2365
2 SASI_Rn02_00276119 predicted 3773
3 SASI_Rn02_00276120 predicted 3041
4 SASI_Rn02_00276121 predicted 2646
5 SASI_Rn02_00276122 predicted 3371
6 SASI_Rn02_00276123 predicted 3844
7 SASI_Rn02_00276124 predicted 3830
8 SASI_Rn02_00276125 predicted 2029
9 SASI_Rn02_00276126 predicted 3134
10 SASI_Rn02_00276127 predicted 3238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393987 predicted 2362
2 SASI_Rn02_00393988 predicted 3770
3 SASI_Rn02_00393989 predicted 2037
4 SASI_Rn02_00393990 predicted 2219
5 SASI_Rn02_00393991 predicted 3850
6 SASI_Rn02_00393992 predicted 3835
7 SASI_Rn02_00393993 predicted 1054
8 SASI_Rn02_00393994 predicted 2024
9 SASI_Rn02_00393995 predicted 1915
10 SASI_Rn02_00393996 predicted 2090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098170 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301227 predicted 3559
2 SASI_Mm02_00301228 predicted 1076
3 SASI_Mm02_00301229 predicted 1060
4 SASI_Mm02_00301230 predicted 3449
5 SASI_Mm02_00301231 predicted 3529
6 SASI_Mm02_00301232 predicted 2188
7 SASI_Mm02_00301233 predicted 3207
8 SASI_Mm02_00301234 predicted 2803
9 SASI_Mm02_00301235 predicted 2452
10 SASI_Mm02_00301236 predicted 3292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301237 predicted 3553
2 SASI_Mm02_00301238 predicted 1085
3 SASI_Mm02_00301239 predicted 1067
4 SASI_Mm02_00301240 predicted 3446
5 SASI_Mm02_00301241 predicted 3532
6 SASI_Mm02_00301242 predicted 2183
7 SASI_Mm02_00301243 predicted 3204
8 SASI_Mm02_00301244 predicted 2805
9 SASI_Mm02_00301245 predicted 2448
10 SASI_Mm02_00301246 predicted 3295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301247 predicted 3561
2 SASI_Mm02_00301248 predicted 1083
3 SASI_Mm02_00301249 predicted 1065
4 SASI_Mm02_00301250 predicted 3928
5 SASI_Mm02_00301251 predicted 3530
6 SASI_Mm02_00301252 predicted 2186
7 SASI_Mm02_00301253 predicted 2809
8 SASI_Mm02_00301254 predicted 2457
9 SASI_Mm02_00301255 predicted 3986
10 SASI_Mm02_00301256 predicted 3296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011043 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185995 predicted 1082
2 SASI_Mm02_00319792 predicted 3482
3 SASI_Mm01_00185998 predicted 2380
4 SASI_Mm01_00185999 predicted 2186
5 SASI_Mm01_00186000 predicted 2806
6 SASI_Mm01_00186001 predicted 2456
7 SASI_Mm01_00186002 predicted 3297
8 SASI_Mm01_00186003 predicted 1819
9 SASI_Mm02_00319793 predicted 1039
10 SASI_Mm02_00319794 predicted 3179
11 SASI_Mm01_00185996 predicted 858
12 SASI_Mm01_00185997 predicted 1611
13 SASI_Mm01_00186004 predicted 3242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011043
PCDH10 MISSION shRNA Bacterial Glycerol Stock
protocadherin 10
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011043.3-3895s21c1
Sequence:CCGGGCATCTGTCCCAGGCATTAATCTCGAGATTAATGCCTGGGACAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011043.3-1715s21c1
Sequence:CCGGACTCGTTCAGTAGTCACATTTCTCGAGAAATGTGACTACTGAACGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011043.3-1086s21c1
Sequence:CCGGGAAGATAGATCGCGAGCAAATCTCGAGATTTGCTCGCGATCTATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011043.2-4125s1c1
Sequence:CCGGGCAAAGAATTTGGCTTGTCAACTCGAGTTGACAAGCCAAATTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011043.2-2782s1c1
Sequence:CCGGCCTCACACTTATCCTTATCATCTCGAGATGATAAGGATAAGTGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011043.2-2315s1c1
Sequence:CCGGGCCACGGTCAACATCTTGATACTCGAGTATCAAGATGTTGACCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011043.2-1107s1c1
Sequence:CCGGCCTTGCGAGACTACGAGATAACTCGAGTTATCTCGTAGTCTCGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011043.2-3085s1c1
Sequence:CCGGCCACAATCAGAACTATTGCTACTCGAGTAGCAATAGTTCTGATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011043
PCDH10 MISSION shRNA shRNA Plasmid DNA
protocadherin 10
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011043.3-3895s21c1
Sequence:CCGGGCATCTGTCCCAGGCATTAATCTCGAGATTAATGCCTGGGACAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011043.3-1715s21c1
Sequence:CCGGACTCGTTCAGTAGTCACATTTCTCGAGAAATGTGACTACTGAACGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011043.3-1086s21c1
Sequence:CCGGGAAGATAGATCGCGAGCAAATCTCGAGATTTGCTCGCGATCTATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011043.2-4125s1c1
Sequence:CCGGGCAAAGAATTTGGCTTGTCAACTCGAGTTGACAAGCCAAATTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011043.2-2782s1c1
Sequence:CCGGCCTCACACTTATCCTTATCATCTCGAGATGATAAGGATAAGTGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011043.2-2315s1c1
Sequence:CCGGGCCACGGTCAACATCTTGATACTCGAGTATCAAGATGTTGACCGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011043.2-1107s1c1
Sequence:CCGGCCTTGCGAGACTACGAGATAACTCGAGTTATCTCGTAGTCTCGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011043.2-3085s1c1
Sequence:CCGGCCACAATCAGAACTATTGCTACTCGAGTAGCAATAGTTCTGATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011043
PCDH10 MISSION shRNA Lentiviral Transduction Particles
protocadherin 10
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011043.3-3895s21c1
Sequence:CCGGGCATCTGTCCCAGGCATTAATCTCGAGATTAATGCCTGGGACAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011043.3-1715s21c1
Sequence:CCGGACTCGTTCAGTAGTCACATTTCTCGAGAAATGTGACTACTGAACGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011043.3-1086s21c1
Sequence:CCGGGAAGATAGATCGCGAGCAAATCTCGAGATTTGCTCGCGATCTATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011043.2-4125s1c1
Sequence:CCGGGCAAAGAATTTGGCTTGTCAACTCGAGTTGACAAGCCAAATTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011043.2-2782s1c1
Sequence:CCGGCCTCACACTTATCCTTATCATCTCGAGATGATAAGGATAAGTGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011043.2-2315s1c1
Sequence:CCGGGCCACGGTCAACATCTTGATACTCGAGTATCAAGATGTTGACCGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011043.2-1107s1c1
Sequence:CCGGCCTTGCGAGACTACGAGATAACTCGAGTTATCTCGTAGTCTCGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011043.2-3085s1c1
Sequence:CCGGCCACAATCAGAACTATTGCTACTCGAGTAGCAATAGTTCTGATTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020815
PCDH10 MISSION shRNA Bacterial Glycerol Stock
protocadherin 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020815.1-3618s21c1
Sequence:CCGGTTCGTGTGTAACCTAACTTTCCTCGAGGAAAGTTAGGTTACACACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020815.1-2683s21c1
Sequence:CCGGCATCGTGCGTGGCAACGAAATCTCGAGATTTCGTTGCCACGCACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020815.1-1154s21c1
Sequence:CCGGATCGAGGTGCTGGACATTAATCTCGAGATTAATGTCCAGCACCTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020815.1-1761s21c1
Sequence:CCGGTAAGCGGCGAGTTGGACTATGCTCGAGCATAGTCCAACTCGCCGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020815.1-2498s1c1
Sequence:CCGGGCCACTGTCAACATCCTCATACTCGAGTATGAGGATGTTGACAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020815.1-2371s1c1
Sequence:CCGGCGTTTCTATCAACTCTGAGAACTCGAGTTCTCAGAGTTGATAGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020815.1-3415s1c1
Sequence:CCGGGCAGCCTGATATCATCTCCAACTCGAGTTGGAGATGATATCAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020815.1-2035s1c1
Sequence:CCGGCCGCCTCAAGTCTTCCTTTAACTCGAGTTAAAGGAAGACTTGAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020815.1-3157s1c1
Sequence:CCGGGCGCAAGAAGAAACTCAGCAACTCGAGTTGCTGAGTTTCTTCTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020815
PCDH10 MISSION shRNA shRNA Plasmid DNA
protocadherin 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020815.1-3618s21c1
Sequence:CCGGTTCGTGTGTAACCTAACTTTCCTCGAGGAAAGTTAGGTTACACACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020815.1-2683s21c1
Sequence:CCGGCATCGTGCGTGGCAACGAAATCTCGAGATTTCGTTGCCACGCACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020815.1-1154s21c1
Sequence:CCGGATCGAGGTGCTGGACATTAATCTCGAGATTAATGTCCAGCACCTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020815.1-1761s21c1
Sequence:CCGGTAAGCGGCGAGTTGGACTATGCTCGAGCATAGTCCAACTCGCCGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020815.1-2498s1c1
Sequence:CCGGGCCACTGTCAACATCCTCATACTCGAGTATGAGGATGTTGACAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020815.1-2371s1c1
Sequence:CCGGCGTTTCTATCAACTCTGAGAACTCGAGTTCTCAGAGTTGATAGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020815.1-3415s1c1
Sequence:CCGGGCAGCCTGATATCATCTCCAACTCGAGTTGGAGATGATATCAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020815.1-2035s1c1
Sequence:CCGGCCGCCTCAAGTCTTCCTTTAACTCGAGTTAAAGGAAGACTTGAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020815.1-3157s1c1
Sequence:CCGGGCGCAAGAAGAAACTCAGCAACTCGAGTTGCTGAGTTTCTTCTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020815
PCDH10 MISSION shRNA Lentiviral Transduction Particles
protocadherin 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020815.1-3618s21c1
Sequence:CCGGTTCGTGTGTAACCTAACTTTCCTCGAGGAAAGTTAGGTTACACACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020815.1-2683s21c1
Sequence:CCGGCATCGTGCGTGGCAACGAAATCTCGAGATTTCGTTGCCACGCACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020815.1-1154s21c1
Sequence:CCGGATCGAGGTGCTGGACATTAATCTCGAGATTAATGTCCAGCACCTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020815.1-1761s21c1
Sequence:CCGGTAAGCGGCGAGTTGGACTATGCTCGAGCATAGTCCAACTCGCCGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020815.1-2498s1c1
Sequence:CCGGGCCACTGTCAACATCCTCATACTCGAGTATGAGGATGTTGACAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020815.1-2371s1c1
Sequence:CCGGCGTTTCTATCAACTCTGAGAACTCGAGTTCTCAGAGTTGATAGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020815.1-3415s1c1
Sequence:CCGGGCAGCCTGATATCATCTCCAACTCGAGTTGGAGATGATATCAGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020815.1-2035s1c1
Sequence:CCGGCCGCCTCAAGTCTTCCTTTAACTCGAGTTAAAGGAAGACTTGAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020815.1-3157s1c1
Sequence:CCGGGCGCAAGAAGAAACTCAGCAACTCGAGTTGCTGAGTTTCTTCTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)