EMAIL THIS PAGE TO A FRIEND

PCDH11X

protocadherin 11 X-linked

269 Gene Product Result for
Synonyms: PCDH-X PCDH11 PCDHX
Gene ID:
Human(27328) Summary: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 7 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene is located in a major X/Y block of homology and its Y homolog, despite divergence leading to coding region changes, is the most closely related cadherin family member. The protein is thought to play a fundamental role in cell-cell recognition essential for the segmental development and function of the central nervous system. Transcripts arising from alternative splicing encode isoforms with variable cytoplasmic domains. [provided by RefSeq, Jul 2008]
Mouse(245578) protocadherin 11 X-linked
Rat(317204) protocadherin 11 X-linked
Zebrafish(100333121) protocadherin 11 X-linked
dog(608881) protocadherin 11 X-linked
domestic cat(101099279) protocadherin 11 X-linked
domestic guinea pig(100726395) protocadherin 11 X-linked
Domestic Rabbit(100350851) protocadherin 11 X-linked
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014522 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014522 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014522 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU161401 MISSION® esiRNA esiRNA targeting mouse Pcdh11x mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014522 Rosetta Predictions human pricing
NM_032967 Rosetta Predictions human pricing
NM_032968 Rosetta Predictions human pricing
NM_032969 Rosetta Predictions human pricing
XM_001055860 Rosetta Predictions rat pricing
XM_228479 Rosetta Predictions rat pricing
NM_001081385 Rosetta Predictions mouse pricing
XM_911050 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066717 predicted 1999
2 SASI_Hs01_00066718 predicted 1365
3 SASI_Hs01_00066719 predicted 1517
4 SASI_Hs02_00345807 predicted 2554
5 SASI_Hs01_00066721 predicted 1266
6 SASI_Hs01_00066722 predicted 2008
7 SASI_Hs01_00066723 predicted 1426
8 SASI_Hs01_00066724 predicted 2935
9 SASI_Hs01_00066725 predicted 1018
10 SASI_Hs01_00066726 predicted 1598
11 SASI_Hs01_00066720 predicted 3003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045772 predicted 1742
2 SASI_Hs01_00045773 predicted 1114
3 SASI_Hs01_00045774 predicted 1269
4 SASI_Hs02_00360594 predicted 2292
5 SASI_Hs01_00045776 predicted 1010
6 SASI_Hs01_00045777 predicted 1753
7 SASI_Hs01_00045778 predicted 1174
8 SASI_Hs01_00045779 predicted 2679
9 SASI_Hs01_00045780 predicted 765
10 SASI_Hs01_00045781 predicted 1334
11 SASI_Hs01_00045775 predicted 2753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184612 predicted 1997
2 SASI_Hs01_00184613 predicted 1373
3 SASI_Hs01_00184614 predicted 1521
4 SASI_Hs02_00360595 predicted 2549
5 SASI_Hs01_00184616 predicted 1268
6 SASI_Hs01_00184617 predicted 2012
7 SASI_Hs01_00184618 predicted 1424
8 SASI_Hs01_00184619 predicted 2934
9 SASI_Hs01_00184620 predicted 1021
10 SASI_Hs01_00184621 predicted 1593
11 SASI_Hs01_00184615 predicted 3006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026692 predicted 1996
2 SASI_Hs01_00026693 predicted 1366
3 SASI_Hs01_00026694 predicted 1524
4 SASI_Hs02_00360596 predicted 2551
5 SASI_Hs01_00026696 predicted 1260
6 SASI_Hs01_00026697 predicted 2007
7 SASI_Hs01_00026698 predicted 1428
8 SASI_Hs01_00026699 predicted 2929
9 SASI_Hs01_00026700 predicted 1019
10 SASI_Hs02_00360597 predicted 3029
11 SASI_Hs01_00026695 predicted 3009
12 SASI_Hs01_00026701 predicted 1604
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281258 predicted 3688
2 SASI_Rn02_00281259 predicted 894
3 SASI_Rn02_00281260 predicted 2623
4 SASI_Rn02_00281261 predicted 1511
5 SASI_Rn02_00281262 predicted 2329
6 SASI_Rn02_00281263 predicted 1471
7 SASI_Rn02_00281264 predicted 1183
8 SASI_Rn02_00281265 predicted 402
9 SASI_Rn02_00281266 predicted 1600
10 SASI_Rn02_00281267 predicted 1994
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228479 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385142 predicted 886
2 SASI_Rn02_00385143 predicted 2619
3 SASI_Rn02_00385144 predicted 1503
4 SASI_Rn02_00385145 predicted 2332
5 SASI_Rn02_00385146 predicted 1476
6 SASI_Rn02_00385147 predicted 475
7 SASI_Rn02_00385148 predicted 1179
8 SASI_Rn02_00385149 predicted 397
9 SASI_Rn02_00385150 predicted 1598
10 SASI_Rn02_00385151 predicted 1996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297881 predicted 1476
2 SASI_Mm02_00297882 predicted 1092
3 SASI_Mm02_00297883 predicted 2426
4 SASI_Mm02_00297884 predicted 893
5 SASI_Mm02_00297885 predicted 2263
6 SASI_Mm02_00297886 predicted 1601
7 SASI_Mm02_00297887 predicted 2619
8 SASI_Mm02_00297888 predicted 4221
9 SASI_Mm02_00297889 predicted 1995
10 SASI_Mm02_00297890 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911050 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217295 predicted 1483
2 SASI_Mm01_00217296 predicted 1102
3 SASI_Mm01_00217297 predicted 2431
4 SASI_Mm01_00217298 predicted 900
5 SASI_Mm01_00217299 predicted 2275
6 SASI_Mm01_00217300 predicted 1611
7 SASI_Mm01_00217301 predicted 2619
8 SASI_Mm01_00217302 predicted 4220
9 SASI_Mm01_00217303 predicted 540
10 SASI_Mm01_00217304 predicted 1601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014522
PCDH11X MISSION shRNA Bacterial Glycerol Stock
protocadherin 11 X-linked
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014522.1-4218s21c1
Sequence:CCGGAGAATAGTCTGGGCTAGATACCTCGAGGTATCTAGCCCAGACTATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014522.1-3874s21c1
Sequence:CCGGGACCGGTAGGTATCCAAGTTTCTCGAGAAACTTGGATACCTACCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014522.1-4229s21c1
Sequence:CCGGGGCTAGATACATCACATTAAACTCGAGTTTAATGTGATGTATCTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014522.1-3887s1c1
Sequence:CCGGCCAAGTTTCTAACACAACTTTCTCGAGAAAGTTGTGTTAGAAACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014522.1-2340s1c1
Sequence:CCGGGCTAAGATCAATTACCTGCTACTCGAGTAGCAGGTAATTGATCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014522.1-3477s1c1
Sequence:CCGGCCTAAGAACTTGCTGCTTAATCTCGAGATTAAGCAGCAAGTTCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014522.1-1901s1c1
Sequence:CCGGCCCATCCATTGACATAAGATACTCGAGTATCTTATGTCAATGGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014522.1-3431s1c1
Sequence:CCGGGCAGATGATAATGATGAAGAACTCGAGTTCTTCATCATTATCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014522.1-4116s21c1
Sequence:CCGGGTAGATGGCAGTATGACAATTCTCGAGAATTGTCATACTGCCATCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014522
PCDH11X MISSION shRNA shRNA Plasmid DNA
protocadherin 11 X-linked
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014522.1-4218s21c1
Sequence:CCGGAGAATAGTCTGGGCTAGATACCTCGAGGTATCTAGCCCAGACTATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014522.1-3874s21c1
Sequence:CCGGGACCGGTAGGTATCCAAGTTTCTCGAGAAACTTGGATACCTACCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014522.1-4229s21c1
Sequence:CCGGGGCTAGATACATCACATTAAACTCGAGTTTAATGTGATGTATCTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014522.1-3887s1c1
Sequence:CCGGCCAAGTTTCTAACACAACTTTCTCGAGAAAGTTGTGTTAGAAACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014522.1-2340s1c1
Sequence:CCGGGCTAAGATCAATTACCTGCTACTCGAGTAGCAGGTAATTGATCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014522.1-3477s1c1
Sequence:CCGGCCTAAGAACTTGCTGCTTAATCTCGAGATTAAGCAGCAAGTTCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014522.1-1901s1c1
Sequence:CCGGCCCATCCATTGACATAAGATACTCGAGTATCTTATGTCAATGGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014522.1-3431s1c1
Sequence:CCGGGCAGATGATAATGATGAAGAACTCGAGTTCTTCATCATTATCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014522.1-4116s21c1
Sequence:CCGGGTAGATGGCAGTATGACAATTCTCGAGAATTGTCATACTGCCATCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014522
PCDH11X MISSION shRNA Lentiviral Transduction Particles
protocadherin 11 X-linked
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014522.1-4218s21c1
Sequence:CCGGAGAATAGTCTGGGCTAGATACCTCGAGGTATCTAGCCCAGACTATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014522.1-3874s21c1
Sequence:CCGGGACCGGTAGGTATCCAAGTTTCTCGAGAAACTTGGATACCTACCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014522.1-4229s21c1
Sequence:CCGGGGCTAGATACATCACATTAAACTCGAGTTTAATGTGATGTATCTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014522.1-3887s1c1
Sequence:CCGGCCAAGTTTCTAACACAACTTTCTCGAGAAAGTTGTGTTAGAAACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014522.1-2340s1c1
Sequence:CCGGGCTAAGATCAATTACCTGCTACTCGAGTAGCAGGTAATTGATCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014522.1-3477s1c1
Sequence:CCGGCCTAAGAACTTGCTGCTTAATCTCGAGATTAAGCAGCAAGTTCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014522.1-1901s1c1
Sequence:CCGGCCCATCCATTGACATAAGATACTCGAGTATCTTATGTCAATGGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014522.1-3431s1c1
Sequence:CCGGGCAGATGATAATGATGAAGAACTCGAGTTCTTCATCATTATCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014522.1-4116s21c1
Sequence:CCGGGTAGATGGCAGTATGACAATTCTCGAGAATTGTCATACTGCCATCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081385
PCDH11X MISSION shRNA Bacterial Glycerol Stock
protocadherin 11 X-linked
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081385.1-505s21c1
Sequence:CCGGGACCTCAACTTGTCGCTTATTCTCGAGAATAAGCGACAAGTTGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081385.1-4266s21c1
Sequence:CCGGTCCCGATGATGACTCAATTAACTCGAGTTAATTGAGTCATCATCGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081385.1-813s21c1
Sequence:CCGGTCCGGAGAACTCGGCTATAAACTCGAGTTTATAGCCGAGTTCTCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081385.1-2335s21c1
Sequence:CCGGACTGCTAGAGTAACCATAAATCTCGAGATTTATGGTTACTCTAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081385.1-2463s21c1
Sequence:CCGGTGTTGCAATTGACGATGATATCTCGAGATATCATCGTCAATTGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081385
PCDH11X MISSION shRNA shRNA Plasmid DNA
protocadherin 11 X-linked
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081385.1-505s21c1
Sequence:CCGGGACCTCAACTTGTCGCTTATTCTCGAGAATAAGCGACAAGTTGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081385.1-4266s21c1
Sequence:CCGGTCCCGATGATGACTCAATTAACTCGAGTTAATTGAGTCATCATCGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081385.1-813s21c1
Sequence:CCGGTCCGGAGAACTCGGCTATAAACTCGAGTTTATAGCCGAGTTCTCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081385.1-2335s21c1
Sequence:CCGGACTGCTAGAGTAACCATAAATCTCGAGATTTATGGTTACTCTAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081385.1-2463s21c1
Sequence:CCGGTGTTGCAATTGACGATGATATCTCGAGATATCATCGTCAATTGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081385
PCDH11X MISSION shRNA Lentiviral Transduction Particles
protocadherin 11 X-linked
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081385.1-505s21c1
Sequence:CCGGGACCTCAACTTGTCGCTTATTCTCGAGAATAAGCGACAAGTTGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081385.1-4266s21c1
Sequence:CCGGTCCCGATGATGACTCAATTAACTCGAGTTAATTGAGTCATCATCGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081385.1-813s21c1
Sequence:CCGGTCCGGAGAACTCGGCTATAAACTCGAGTTTATAGCCGAGTTCTCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081385.1-2335s21c1
Sequence:CCGGACTGCTAGAGTAACCATAAATCTCGAGATTTATGGTTACTCTAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081385.1-2463s21c1
Sequence:CCGGTGTTGCAATTGACGATGATATCTCGAGATATCATCGTCAATTGCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)