EMAIL THIS PAGE TO A FRIEND

PCDH11Y

protocadherin 11 Y-linked

213 Gene Product Result for
Synonyms: PCDH-PC PCDH22 PCDHY
Species: Human PCDH11Y(83259)
Gene ID:
Human(83259) Summary: This gene belongs to the protocadherin family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing seven cadherin repeats, a transmembrane domain, and a cytoplasmic tail that differs from those of the classical cadherins. This gene is located on the Y chromosome in a block of X/Y homology and is very closely related to its paralog on the X chromosome. The protein is thought to play a role in cell-cell recognition during development of the central nervous system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032971 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032971 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032971 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032971 Rosetta Predictions human pricing
NM_032972 Rosetta Predictions human pricing
NM_032973 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187716 predicted 1728
2 SASI_Hs01_00187717 predicted 1103
3 SASI_Hs01_00187718 predicted 1250
4 SASI_Hs01_00187719 predicted 1000
5 SASI_Hs01_00187720 predicted 1740
6 SASI_Hs01_00187721 predicted 1161
7 SASI_Hs01_00187722 predicted 2659
8 SASI_Hs01_00187724 predicted 2762
9 SASI_Hs01_00187725 predicted 746
10 SASI_Hs02_00360600 predicted 2030
11 SASI_Hs01_00187723 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158514 predicted 1981
2 SASI_Hs01_00158515 predicted 1353
3 SASI_Hs01_00158516 predicted 1503
4 SASI_Hs01_00158517 predicted 1245
5 SASI_Hs01_00158518 predicted 2000
6 SASI_Hs01_00158519 predicted 1413
7 SASI_Hs01_00158520 predicted 2915
8 SASI_Hs01_00158522 predicted 3016
9 SASI_Hs01_00158523 predicted 1000
10 SASI_Hs02_00360601 predicted 2287
11 SASI_Hs01_00158521 predicted 1588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099962 predicted 1984
2 SASI_Hs01_00099963 predicted 1352
3 SASI_Hs01_00099964 predicted 1511
4 SASI_Hs01_00099965 predicted 1248
5 SASI_Hs01_00099966 predicted 1996
6 SASI_Hs01_00099967 predicted 1412
7 SASI_Hs01_00099968 predicted 2912
8 SASI_Hs01_00099970 predicted 3020
9 SASI_Hs01_00099971 predicted 1004
10 SASI_Hs02_00360602 predicted 2280
11 SASI_Hs01_00099969 predicted 1580
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032971
PCDH11Y MISSION shRNA Bacterial Glycerol Stock
protocadherin 11 Y-linked
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032971.1-3416s1c1
Sequence:CCGGCCTTCCAAATTCAGCCTGAAACTCGAGTTTCAGGCTGAATTTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032971.1-1663s1c1
Sequence:CCGGCCTGTCAATGACACAGTTGTTCTCGAGAACAACTGTGTCATTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032971.1-877s1c1
Sequence:CCGGCCAAGGGATGAGCATTGCTTTCTCGAGAAAGCAATGCTCATCCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032971.1-1803s1c1
Sequence:CCGGGCCAGTATTCAGTAATCAGTTCTCGAGAACTGATTACTGAATACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032971.1-3219s1c1
Sequence:CCGGGCTGCTTAATGTTGTCACTATCTCGAGATAGTGACAACATTAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032971.1-4045s21c1
Sequence:CCGGGTGAGCTGAACTAGCCAAACTCTCGAGAGTTTGGCTAGTTCAGCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032971.1-3822s21c1
Sequence:CCGGGTAATCTGGCAATGGAAATTTCTCGAGAAATTTCCATTGCCAGATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032971.1-3984s21c1
Sequence:CCGGTGCAATTACTTGCCCTGTCTGCTCGAGCAGACAGGGCAAGTAATTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032971
PCDH11Y MISSION shRNA shRNA Plasmid DNA
protocadherin 11 Y-linked
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032971.1-3416s1c1
Sequence:CCGGCCTTCCAAATTCAGCCTGAAACTCGAGTTTCAGGCTGAATTTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032971.1-1663s1c1
Sequence:CCGGCCTGTCAATGACACAGTTGTTCTCGAGAACAACTGTGTCATTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032971.1-877s1c1
Sequence:CCGGCCAAGGGATGAGCATTGCTTTCTCGAGAAAGCAATGCTCATCCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032971.1-1803s1c1
Sequence:CCGGGCCAGTATTCAGTAATCAGTTCTCGAGAACTGATTACTGAATACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032971.1-3219s1c1
Sequence:CCGGGCTGCTTAATGTTGTCACTATCTCGAGATAGTGACAACATTAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032971.1-4045s21c1
Sequence:CCGGGTGAGCTGAACTAGCCAAACTCTCGAGAGTTTGGCTAGTTCAGCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032971.1-3822s21c1
Sequence:CCGGGTAATCTGGCAATGGAAATTTCTCGAGAAATTTCCATTGCCAGATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032971.1-3984s21c1
Sequence:CCGGTGCAATTACTTGCCCTGTCTGCTCGAGCAGACAGGGCAAGTAATTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032971
PCDH11Y MISSION shRNA Lentiviral Transduction Particles
protocadherin 11 Y-linked
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032971.1-3416s1c1
Sequence:CCGGCCTTCCAAATTCAGCCTGAAACTCGAGTTTCAGGCTGAATTTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032971.1-1663s1c1
Sequence:CCGGCCTGTCAATGACACAGTTGTTCTCGAGAACAACTGTGTCATTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032971.1-877s1c1
Sequence:CCGGCCAAGGGATGAGCATTGCTTTCTCGAGAAAGCAATGCTCATCCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032971.1-1803s1c1
Sequence:CCGGGCCAGTATTCAGTAATCAGTTCTCGAGAACTGATTACTGAATACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032971.1-3219s1c1
Sequence:CCGGGCTGCTTAATGTTGTCACTATCTCGAGATAGTGACAACATTAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032971.1-4045s21c1
Sequence:CCGGGTGAGCTGAACTAGCCAAACTCTCGAGAGTTTGGCTAGTTCAGCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032971.1-3822s21c1
Sequence:CCGGGTAATCTGGCAATGGAAATTTCTCGAGAAATTTCCATTGCCAGATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032971.1-3984s21c1
Sequence:CCGGTGCAATTACTTGCCCTGTCTGCTCGAGCAGACAGGGCAAGTAATTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)