EMAIL THIS PAGE TO A FRIEND

PCDH12

protocadherin 12

76 Gene Product Result for
Synonyms: VE-cadherin-2 VECAD2
UniProtKB ID: Q9NPG4, Q6UXB6, Q96KB8, Q9H7Y6, Q9H8E0
Gene ID:
Human(51294) Summary: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]
Mouse(53601) protocadherin 12
Rat(116808) protocadherin 12
Zebrafish(555419) protocadherin 12
Horse(100072150) protocadherin 12
domestic cat(101081023) protocadherin 12
dog(487191) protocadherin 12
chicken(416191) protocadherin 12
naked mole-rat(101713614) protocadherin 12
cow(540115) protocadherin 12
sheep(101106077) protocadherin 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016580 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016580 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016580 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017378 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017378 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017378 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033341 MISSION® esiRNA esiRNA human PCDH12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016580 Rosetta Predictions human pricing
XM_001068741 Rosetta Predictions rat pricing
XM_344673 Rosetta Predictions rat pricing
NM_017378 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196911 predicted 2359
2 SASI_Hs01_00196912 predicted 1297
3 SASI_Hs01_00196913 predicted 2435
4 SASI_Hs01_00196914 predicted 2523
5 SASI_Hs01_00196915 predicted 1945
6 SASI_Hs01_00196916 predicted 4196
7 SASI_Hs01_00196917 predicted 2415
8 SASI_Hs01_00196918 predicted 2721
9 SASI_Hs01_00196919 predicted 3061
10 SASI_Hs01_00196920 predicted 4407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068741 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325679 predicted 3946
2 SASI_Rn02_00325680 predicted 1104
3 SASI_Rn02_00325681 predicted 548
4 SASI_Rn02_00325682 predicted 2697
5 SASI_Rn02_00325683 predicted 3520
6 SASI_Rn02_00325684 predicted 2720
7 SASI_Rn02_00325685 predicted 3652
8 SASI_Rn02_00325686 predicted 1305
9 SASI_Rn02_00325687 predicted 1492
10 SASI_Rn02_00325688 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344673 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397427 predicted 1910
2 SASI_Rn02_00397428 predicted 1104
3 SASI_Rn02_00397429 predicted 552
4 SASI_Rn02_00397430 predicted 419
5 SASI_Rn02_00397431 predicted 1059
6 SASI_Rn02_00397432 predicted 1194
7 SASI_Rn02_00397433 predicted 1303
8 SASI_Rn02_00397434 predicted 1489
9 SASI_Rn02_00397435 predicted 1588
10 SASI_Rn02_00397436 predicted 1335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323871 predicted 1748
2 SASI_Mm01_00106946 predicted 2230
3 SASI_Mm01_00106948 predicted 1006
4 SASI_Mm02_00323872 predicted 2692
5 SASI_Mm01_00106949 predicted 1837
6 SASI_Mm01_00106950 predicted 2134
7 SASI_Mm01_00106952 predicted 822
8 SASI_Mm01_00106953 predicted 1061
9 SASI_Mm01_00106954 predicted 1479
10 SASI_Mm02_00323873 predicted 3864
11 SASI_Mm01_00106947 predicted 689
12 SASI_Mm01_00106951 predicted 3210
13 SASI_Mm01_00106955 predicted 3567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016580
PCDH12 MISSION shRNA Bacterial Glycerol Stock
protocadherin 12
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016580.2-4868s1c1
Sequence:CCGGGAGAACTTTAGGGTGACTGATCTCGAGATCAGTCACCCTAAAGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016580.2-2873s1c1
Sequence:CCGGCCTCTTGGATGCCAATGATAACTCGAGTTATCATTGGCATCCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016580.2-1818s1c1
Sequence:CCGGGACAGGGAAATCCATTCATTTCTCGAGAAATGAATGGATTTCCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016580.2-3407s1c1
Sequence:CCGGCCTGGCTTTGTTCATGTCCATCTCGAGATGGACATGAACAAAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016580.2-1959s1c1
Sequence:CCGGGCACTGGAAATCCAAGAAGATCTCGAGATCTTCTTGGATTTCCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016580.2-1959s1c2
Sequence:CCGGGCACTGGAAATCCAAGAAGATCTCGAGATCTTCTTGGATTTCCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016580.2-4868s1c2
Sequence:CCGGGAGAACTTTAGGGTGACTGATCTCGAGATCAGTCACCCTAAAGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016580.2-4983s21c1
Sequence:CCGGGACGGTTTGTGGCTGAGATAACTCGAGTTATCTCAGCCACAAACCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016580.2-2721s21c1
Sequence:CCGGGTTGCTCACTTAGTAGCTATTCTCGAGAATAGCTACTAAGTGAGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016580
PCDH12 MISSION shRNA shRNA Plasmid DNA
protocadherin 12
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016580.2-4868s1c1
Sequence:CCGGGAGAACTTTAGGGTGACTGATCTCGAGATCAGTCACCCTAAAGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016580.2-2873s1c1
Sequence:CCGGCCTCTTGGATGCCAATGATAACTCGAGTTATCATTGGCATCCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016580.2-1818s1c1
Sequence:CCGGGACAGGGAAATCCATTCATTTCTCGAGAAATGAATGGATTTCCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016580.2-3407s1c1
Sequence:CCGGCCTGGCTTTGTTCATGTCCATCTCGAGATGGACATGAACAAAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016580.2-1959s1c1
Sequence:CCGGGCACTGGAAATCCAAGAAGATCTCGAGATCTTCTTGGATTTCCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016580.2-1959s1c2
Sequence:CCGGGCACTGGAAATCCAAGAAGATCTCGAGATCTTCTTGGATTTCCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016580.2-4868s1c2
Sequence:CCGGGAGAACTTTAGGGTGACTGATCTCGAGATCAGTCACCCTAAAGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016580.2-4983s21c1
Sequence:CCGGGACGGTTTGTGGCTGAGATAACTCGAGTTATCTCAGCCACAAACCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016580.2-2721s21c1
Sequence:CCGGGTTGCTCACTTAGTAGCTATTCTCGAGAATAGCTACTAAGTGAGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016580
PCDH12 MISSION shRNA Lentiviral Transduction Particles
protocadherin 12
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016580.2-4868s1c1
Sequence:CCGGGAGAACTTTAGGGTGACTGATCTCGAGATCAGTCACCCTAAAGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016580.2-2873s1c1
Sequence:CCGGCCTCTTGGATGCCAATGATAACTCGAGTTATCATTGGCATCCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016580.2-1818s1c1
Sequence:CCGGGACAGGGAAATCCATTCATTTCTCGAGAAATGAATGGATTTCCCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016580.2-3407s1c1
Sequence:CCGGCCTGGCTTTGTTCATGTCCATCTCGAGATGGACATGAACAAAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016580.2-1959s1c1
Sequence:CCGGGCACTGGAAATCCAAGAAGATCTCGAGATCTTCTTGGATTTCCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016580.2-1959s1c2
Sequence:CCGGGCACTGGAAATCCAAGAAGATCTCGAGATCTTCTTGGATTTCCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016580.2-4868s1c2
Sequence:CCGGGAGAACTTTAGGGTGACTGATCTCGAGATCAGTCACCCTAAAGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016580.2-4983s21c1
Sequence:CCGGGACGGTTTGTGGCTGAGATAACTCGAGTTATCTCAGCCACAAACCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016580.2-2721s21c1
Sequence:CCGGGTTGCTCACTTAGTAGCTATTCTCGAGAATAGCTACTAAGTGAGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017378
PCDH12 MISSION shRNA Bacterial Glycerol Stock
protocadherin 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017378.1-1803s1c1
Sequence:CCGGCCCGTTTCTCACTTAGTCATTCTCGAGAATGACTAAGTGAGAAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017378.1-787s1c1
Sequence:CCGGCGGGTCCTAACAGCTTATATTCTCGAGAATATAAGCTGTTAGGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017378.1-3233s1c1
Sequence:CCGGCCACCGAGGAAATAAATACTTCTCGAGAAGTATTTATTTCCTCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017378.1-3033s1c1
Sequence:CCGGCAGCGGAATTTCAATGGCAAACTCGAGTTTGCCATTGAAATTCCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017378.1-785s1c1
Sequence:CCGGCACGGGTCCTAACAGCTTATACTCGAGTATAAGCTGTTAGGACCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017378
PCDH12 MISSION shRNA shRNA Plasmid DNA
protocadherin 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017378.1-1803s1c1
Sequence:CCGGCCCGTTTCTCACTTAGTCATTCTCGAGAATGACTAAGTGAGAAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017378.1-787s1c1
Sequence:CCGGCGGGTCCTAACAGCTTATATTCTCGAGAATATAAGCTGTTAGGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017378.1-3233s1c1
Sequence:CCGGCCACCGAGGAAATAAATACTTCTCGAGAAGTATTTATTTCCTCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017378.1-3033s1c1
Sequence:CCGGCAGCGGAATTTCAATGGCAAACTCGAGTTTGCCATTGAAATTCCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017378.1-785s1c1
Sequence:CCGGCACGGGTCCTAACAGCTTATACTCGAGTATAAGCTGTTAGGACCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017378
PCDH12 MISSION shRNA Lentiviral Transduction Particles
protocadherin 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017378.1-1803s1c1
Sequence:CCGGCCCGTTTCTCACTTAGTCATTCTCGAGAATGACTAAGTGAGAAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017378.1-787s1c1
Sequence:CCGGCGGGTCCTAACAGCTTATATTCTCGAGAATATAAGCTGTTAGGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017378.1-3233s1c1
Sequence:CCGGCCACCGAGGAAATAAATACTTCTCGAGAAGTATTTATTTCCTCGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017378.1-3033s1c1
Sequence:CCGGCAGCGGAATTTCAATGGCAAACTCGAGTTTGCCATTGAAATTCCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017378.1-785s1c1
Sequence:CCGGCACGGGTCCTAACAGCTTATACTCGAGTATAAGCTGTTAGGACCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)