EMAIL THIS PAGE TO A FRIEND

PCDH15

protocadherin-related 15

71 Gene Product Result for
Synonyms: CDHR15 DFNB23 USH1F
Gene ID:
Human(65217) Summary: This gene is a member of the cadherin superfamily. Family members encode integral membrane proteins that mediate calcium-dependent cell-cell adhesion. It plays an essential role in maintenance of normal retinal and cochlear function. Mutations in this gene result in hearing loss and Usher Syndrome Type IF (USH1F). Extensive alternative splicing resulting in multiple isoforms has been observed in the mouse ortholog. Similar alternatively spliced transcripts are inferred to occur in human, and additional variants are likely to occur. [provided by RefSeq, Dec 2008]
Mouse(11994) protocadherin 15
Rat(690865) protocadherin 15
sheep(101115841) protocadherin-related 15
domestic guinea pig(100718043) protocadherin-related 15
naked mole-rat(101703308) protocadherin-related 15
Domestic Rabbit(100328642) protocadherin-related 15
chicken(423644) protocadherin-related 15
Horse(100071973) protocadherin-related 15
domestic cat(101088616) protocadherin-related 15
dog(609280) protocadherin-related 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV50153 Anti-PCDH15 antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, rat, human, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033056 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023115 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023115 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023115 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079621 MISSION® esiRNA esiRNA human PCDH15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033056 Rosetta Predictions human pricing
XM_001075929 Rosetta Predictions rat pricing
NM_023115 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206772 predicted 4050
2 SASI_Hs02_00360749 predicted 882
3 SASI_Hs01_00206774 predicted 933
4 SASI_Hs01_00206775 predicted 4352
5 SASI_Hs01_00206776 predicted 4190
6 SASI_Hs01_00206777 predicted 3661
7 SASI_Hs01_00206778 predicted 2676
8 SASI_Hs01_00206779 predicted 633
9 SASI_Hs01_00206780 predicted 1296
10 SASI_Hs02_00360750 predicted 2742
11 SASI_Hs01_00206773 predicted 2651
12 SASI_Hs01_00206781 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075929 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351538 predicted 621
2 SASI_Rn02_00351539 predicted 1748
3 SASI_Rn02_00351540 predicted 851
4 SASI_Rn02_00351541 predicted 929
5 SASI_Rn02_00351542 predicted 1207
6 SASI_Rn02_00351543 predicted 674
7 SASI_Rn02_00351544 predicted 2843
8 SASI_Rn02_00351545 predicted 3678
9 SASI_Rn02_00351546 predicted 4415
10 SASI_Rn02_00351547 predicted 4861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023115 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101426 predicted 961
2 SASI_Mm02_00326796 predicted 1321
3 SASI_Mm01_00101427 predicted 1564
4 SASI_Mm01_00101428 predicted 3722
5 SASI_Mm02_00326797 predicted 6228
6 SASI_Mm01_00101430 predicted 4076
7 SASI_Mm01_00101431 predicted 542
8 SASI_Mm01_00101432 predicted 1752
9 SASI_Mm01_00101433 predicted 1952
10 SASI_Mm01_00101434 predicted 6178
11 SASI_Mm01_00101429 predicted 1259
12 SASI_Mm01_00101435 predicted 3610
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033056
PCDH15 MISSION shRNA Bacterial Glycerol Stock
protocadherin-related 15
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033056.3-2139s21c1
Sequence:CCGGACGGTCCAAGCAGCGGATAATCTCGAGATTATCCGCTGCTTGGACCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033056.3-6425s21c1
Sequence:CCGGACTACTAACTCACTCATATAACTCGAGTTATATGAGTGAGTTAGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033056.3-1864s21c1
Sequence:CCGGGTGAGCCAGTCATCGTCAATACTCGAGTATTGACGATGACTGGCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033056.2-606s1c1
Sequence:CCGGCCCACCATAGAACTTTCTTTACTCGAGTAAAGAAAGTTCTATGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033056.2-4212s1c1
Sequence:CCGGCGCTATGTTCAGGAACAAATTCTCGAGAATTTGTTCCTGAACATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033056.2-4728s1c1
Sequence:CCGGGCGCATCTCTATGAAGAACTTCTCGAGAAGTTCTTCATAGAGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033056.2-1530s1c1
Sequence:CCGGGCCGGTCTACACATTGAAATACTCGAGTATTTCAATGTGTAGACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033056.2-6151s1c1
Sequence:CCGGGCCCTTCAGAAGTAACAAATACTCGAGTATTTGTTACTTCTGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033056
PCDH15 MISSION shRNA shRNA Plasmid DNA
protocadherin-related 15
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033056.3-2139s21c1
Sequence:CCGGACGGTCCAAGCAGCGGATAATCTCGAGATTATCCGCTGCTTGGACCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033056.3-6425s21c1
Sequence:CCGGACTACTAACTCACTCATATAACTCGAGTTATATGAGTGAGTTAGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033056.3-1864s21c1
Sequence:CCGGGTGAGCCAGTCATCGTCAATACTCGAGTATTGACGATGACTGGCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033056.2-606s1c1
Sequence:CCGGCCCACCATAGAACTTTCTTTACTCGAGTAAAGAAAGTTCTATGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033056.2-4212s1c1
Sequence:CCGGCGCTATGTTCAGGAACAAATTCTCGAGAATTTGTTCCTGAACATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033056.2-4728s1c1
Sequence:CCGGGCGCATCTCTATGAAGAACTTCTCGAGAAGTTCTTCATAGAGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033056.2-1530s1c1
Sequence:CCGGGCCGGTCTACACATTGAAATACTCGAGTATTTCAATGTGTAGACCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033056.2-6151s1c1
Sequence:CCGGGCCCTTCAGAAGTAACAAATACTCGAGTATTTGTTACTTCTGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033056
PCDH15 MISSION shRNA Lentiviral Transduction Particles
protocadherin-related 15
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033056.3-2139s21c1
Sequence:CCGGACGGTCCAAGCAGCGGATAATCTCGAGATTATCCGCTGCTTGGACCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033056.3-6425s21c1
Sequence:CCGGACTACTAACTCACTCATATAACTCGAGTTATATGAGTGAGTTAGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033056.3-1864s21c1
Sequence:CCGGGTGAGCCAGTCATCGTCAATACTCGAGTATTGACGATGACTGGCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033056.2-606s1c1
Sequence:CCGGCCCACCATAGAACTTTCTTTACTCGAGTAAAGAAAGTTCTATGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033056.2-4212s1c1
Sequence:CCGGCGCTATGTTCAGGAACAAATTCTCGAGAATTTGTTCCTGAACATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033056.2-4728s1c1
Sequence:CCGGGCGCATCTCTATGAAGAACTTCTCGAGAAGTTCTTCATAGAGATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033056.2-1530s1c1
Sequence:CCGGGCCGGTCTACACATTGAAATACTCGAGTATTTCAATGTGTAGACCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033056.2-6151s1c1
Sequence:CCGGGCCCTTCAGAAGTAACAAATACTCGAGTATTTGTTACTTCTGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023115
PCDH15 MISSION shRNA Bacterial Glycerol Stock
protocadherin-related 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023115.1-6665s1c1
Sequence:CCGGGCTCTCTCTTTGGCTTGTTATCTCGAGATAACAAGCCAAAGAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023115.1-4142s1c1
Sequence:CCGGCCGTGGTCAATCAACTGGATACTCGAGTATCCAGTTGATTGACCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023115.1-1294s1c1
Sequence:CCGGCCGGAAGAACTGAACCCTATTCTCGAGAATAGGGTTCAGTTCTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023115.1-5477s1c1
Sequence:CCGGCGGAACCTAATGTGGTCACTTCTCGAGAAGTGACCACATTAGGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023115.1-4143s1c1
Sequence:CCGGCGTGGTCAATCAACTGGATATCTCGAGATATCCAGTTGATTGACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023115
PCDH15 MISSION shRNA shRNA Plasmid DNA
protocadherin-related 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023115.1-6665s1c1
Sequence:CCGGGCTCTCTCTTTGGCTTGTTATCTCGAGATAACAAGCCAAAGAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023115.1-4142s1c1
Sequence:CCGGCCGTGGTCAATCAACTGGATACTCGAGTATCCAGTTGATTGACCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023115.1-1294s1c1
Sequence:CCGGCCGGAAGAACTGAACCCTATTCTCGAGAATAGGGTTCAGTTCTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023115.1-5477s1c1
Sequence:CCGGCGGAACCTAATGTGGTCACTTCTCGAGAAGTGACCACATTAGGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023115.1-4143s1c1
Sequence:CCGGCGTGGTCAATCAACTGGATATCTCGAGATATCCAGTTGATTGACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023115
PCDH15 MISSION shRNA Lentiviral Transduction Particles
protocadherin-related 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023115.1-6665s1c1
Sequence:CCGGGCTCTCTCTTTGGCTTGTTATCTCGAGATAACAAGCCAAAGAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023115.1-4142s1c1
Sequence:CCGGCCGTGGTCAATCAACTGGATACTCGAGTATCCAGTTGATTGACCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023115.1-1294s1c1
Sequence:CCGGCCGGAAGAACTGAACCCTATTCTCGAGAATAGGGTTCAGTTCTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023115.1-5477s1c1
Sequence:CCGGCGGAACCTAATGTGGTCACTTCTCGAGAAGTGACCACATTAGGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023115.1-4143s1c1
Sequence:CCGGCGTGGTCAATCAACTGGATATCTCGAGATATCCAGTTGATTGACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)