EMAIL THIS PAGE TO A FRIEND

PCDH17

protocadherin 17

230 Gene Product Result for
Synonyms: PCDH68 PCH68
UniProtKB ID: O14917, A8K1R5, Q5VVW9, Q5VVX0
Gene ID:
Human(27253) Summary: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Jul 2008]
Mouse(219228) protocadherin 17
Rat(306055) protocadherin 17
Zebrafish(561336) protocadherin 17
Horse(100051691) protocadherin 17
domestic cat(101093827) protocadherin 17
chicken(418825) protocadherin 17
naked mole-rat(101709706) protocadherin 17
cow(510554) protocadherin 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108080 Anti-PCDH17 antibody produced in rabbit affinity isolated antibody rat, guinea pig, mouse, human, dog, horse, rabbit
western blot pricing
HPA026817 Anti-PCDH17 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040429 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014459 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040429 Rosetta Predictions human pricing
NM_001107279 Rosetta Predictions rat pricing
NM_001013753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138034 predicted 3517
2 SASI_Hs01_00138035 predicted 3629
3 SASI_Hs01_00138036 predicted 3503
4 SASI_Hs02_00308957 predicted 2919
5 SASI_Hs01_00138037 predicted 3812
6 SASI_Hs01_00138038 predicted 1801
7 SASI_Hs01_00138039 predicted 4095
8 SASI_Hs01_00138041 predicted 3575
9 SASI_Hs01_00138042 predicted 3810
10 SASI_Hs01_00138043 predicted 3694
11 SASI_Hs01_00138040 predicted 3960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227275 predicted 2227
2 SASI_Rn02_00227276 predicted 3130
3 SASI_Rn02_00227277 predicted 2076
4 SASI_Rn02_00227278 predicted 2378
5 SASI_Rn02_00227279 predicted 720
6 SASI_Rn02_00227280 predicted 1605
7 SASI_Rn02_00227281 predicted 1191
8 SASI_Rn02_00227282 predicted 480
9 SASI_Rn02_00227283 predicted 1912
10 SASI_Rn02_00227284 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160637 predicted 3031
2 SASI_Mm01_00160638 predicted 2798
3 SASI_Mm01_00160639 predicted 1439
4 SASI_Mm01_00160640 predicted 2591
5 SASI_Mm01_00160641 predicted 3537
6 SASI_Mm01_00160642 predicted 698
7 SASI_Mm01_00160643 predicted 2758
8 SASI_Mm01_00160644 predicted 1653
9 SASI_Mm01_00160645 predicted 3335
10 SASI_Mm01_00160646 predicted 936
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040429
PCDH17 MISSION shRNA Bacterial Glycerol Stock
protocadherin 17
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000373166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040429.2-1914s21c1
Sequence:CCGGTCATCGACCGCAACGACAATGCTCGAGCATTGTCGTTGCGGTCGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040429.2-3929s21c1
Sequence:CCGGGCCAACGTTAAACCTTATTTACTCGAGTAAATAAGGTTTAACGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040429.2-4736s21c1
Sequence:CCGGCAGACTGTCCTCCGTGATTTACTCGAGTAAATCACGGAGGACAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040429
PCDH17 MISSION shRNA shRNA Plasmid DNA
protocadherin 17
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000373166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040429.2-1914s21c1
Sequence:CCGGTCATCGACCGCAACGACAATGCTCGAGCATTGTCGTTGCGGTCGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040429.2-3929s21c1
Sequence:CCGGGCCAACGTTAAACCTTATTTACTCGAGTAAATAAGGTTTAACGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040429.2-4736s21c1
Sequence:CCGGCAGACTGTCCTCCGTGATTTACTCGAGTAAATCACGGAGGACAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040429
PCDH17 MISSION shRNA Lentiviral Transduction Particles
protocadherin 17
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000373166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040429.2-1914s21c1
Sequence:CCGGTCATCGACCGCAACGACAATGCTCGAGCATTGTCGTTGCGGTCGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040429.2-3929s21c1
Sequence:CCGGGCCAACGTTAAACCTTATTTACTCGAGTAAATAAGGTTTAACGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040429.2-4736s21c1
Sequence:CCGGCAGACTGTCCTCCGTGATTTACTCGAGTAAATCACGGAGGACAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013753
PCDH17 MISSION shRNA Bacterial Glycerol Stock
protocadherin 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013753.1-3341s1c1
Sequence:CCGGCCCACAGTTGAAGCTAATGTTCTCGAGAACATTAGCTTCAACTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013753.1-2595s1c1
Sequence:CCGGCTGTCAAGTGTAAACGGGAAACTCGAGTTTCCCGTTTACACTTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013753.1-4298s1c1
Sequence:CCGGCCCATACAAAGCAGGGTCATACTCGAGTATGACCCTGCTTTGTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013753.1-1966s1c1
Sequence:CCGGCGACGTGTCTATTTACACCTACTCGAGTAGGTGTAAATAGACACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013753.1-3200s1c1
Sequence:CCGGCCACTCGAACAAGAACCAGAACTCGAGTTCTGGTTCTTGTTCGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013753
PCDH17 MISSION shRNA shRNA Plasmid DNA
protocadherin 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013753.1-3341s1c1
Sequence:CCGGCCCACAGTTGAAGCTAATGTTCTCGAGAACATTAGCTTCAACTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013753.1-2595s1c1
Sequence:CCGGCTGTCAAGTGTAAACGGGAAACTCGAGTTTCCCGTTTACACTTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013753.1-4298s1c1
Sequence:CCGGCCCATACAAAGCAGGGTCATACTCGAGTATGACCCTGCTTTGTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013753.1-1966s1c1
Sequence:CCGGCGACGTGTCTATTTACACCTACTCGAGTAGGTGTAAATAGACACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013753.1-3200s1c1
Sequence:CCGGCCACTCGAACAAGAACCAGAACTCGAGTTCTGGTTCTTGTTCGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013753
PCDH17 MISSION shRNA Lentiviral Transduction Particles
protocadherin 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013753.1-3341s1c1
Sequence:CCGGCCCACAGTTGAAGCTAATGTTCTCGAGAACATTAGCTTCAACTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013753.1-2595s1c1
Sequence:CCGGCTGTCAAGTGTAAACGGGAAACTCGAGTTTCCCGTTTACACTTGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013753.1-4298s1c1
Sequence:CCGGCCCATACAAAGCAGGGTCATACTCGAGTATGACCCTGCTTTGTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013753.1-1966s1c1
Sequence:CCGGCGACGTGTCTATTTACACCTACTCGAGTAGGTGTAAATAGACACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013753.1-3200s1c1
Sequence:CCGGCCACTCGAACAAGAACCAGAACTCGAGTTCTGGTTCTTGTTCGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014459
PCDH17 MISSION shRNA Bacterial Glycerol Stock
protocadherin 17
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014459.2-2288s1c1
Sequence:CCGGCGACGTGTCTATCTACACCTACTCGAGTAGGTGTAGATAGACACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014459.2-3279s1c1
Sequence:CCGGGCCACTCGGATGTCCATAATTCTCGAGAATTATGGACATCCGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014459.2-2033s1c1
Sequence:CCGGCGAGACACAAGACGAGTACAACTCGAGTTGTACTCGTCTTGTGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014459.2-3375s1c1
Sequence:CCGGCCACGTTTAAGGACCCAGAAACTCGAGTTTCTGGGTCCTTAAACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014459.2-1148s1c1
Sequence:CCGGCGAAATGGACATCTCGGAGAACTCGAGTTCTCCGAGATGTCCATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014459
PCDH17 MISSION shRNA shRNA Plasmid DNA
protocadherin 17
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014459.2-2288s1c1
Sequence:CCGGCGACGTGTCTATCTACACCTACTCGAGTAGGTGTAGATAGACACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014459.2-3279s1c1
Sequence:CCGGGCCACTCGGATGTCCATAATTCTCGAGAATTATGGACATCCGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014459.2-2033s1c1
Sequence:CCGGCGAGACACAAGACGAGTACAACTCGAGTTGTACTCGTCTTGTGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014459.2-3375s1c1
Sequence:CCGGCCACGTTTAAGGACCCAGAAACTCGAGTTTCTGGGTCCTTAAACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014459.2-1148s1c1
Sequence:CCGGCGAAATGGACATCTCGGAGAACTCGAGTTCTCCGAGATGTCCATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014459
PCDH17 MISSION shRNA Lentiviral Transduction Particles
protocadherin 17
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014459.2-2288s1c1
Sequence:CCGGCGACGTGTCTATCTACACCTACTCGAGTAGGTGTAGATAGACACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014459.2-3279s1c1
Sequence:CCGGGCCACTCGGATGTCCATAATTCTCGAGAATTATGGACATCCGAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014459.2-2033s1c1
Sequence:CCGGCGAGACACAAGACGAGTACAACTCGAGTTGTACTCGTCTTGTGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014459.2-3375s1c1
Sequence:CCGGCCACGTTTAAGGACCCAGAAACTCGAGTTTCTGGGTCCTTAAACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014459.2-1148s1c1
Sequence:CCGGCGAAATGGACATCTCGGAGAACTCGAGTTCTCCGAGATGTCCATTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)