EMAIL THIS PAGE TO A FRIEND

PCDH18

protocadherin 18

100 Gene Product Result for
Synonyms: PCDH68L
UniProtKB ID: Q9HCL0, A8K7K3, B7ZKT1, Q52LS2
Gene ID:
Human(54510) Summary: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Although its specific function is undetermined, the cadherin-related neuronal receptor is thought to play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Jul 2008]
Mouse(73173) protocadherin 18
Rat(295027) protocadherin 18
cow(539464) protocadherin 18
sheep(101118052) protocadherin 18
naked mole-rat(101708334) protocadherin 18
Domestic Rabbit(100350767) protocadherin 18
chicken(422438) protocadherin 18
Horse(100063465) protocadherin 18
domestic cat(101100886) protocadherin 18
dog(100686323) protocadherin 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019035 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019035 Rosetta Predictions human pricing
NM_001100524 Rosetta Predictions rat pricing
NM_130448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070203 predicted 1830
2 SASI_Hs02_00352593 predicted 500
3 SASI_Hs01_00070204 predicted 3045
4 SASI_Hs01_00070206 predicted 602
5 SASI_Hs01_00070207 predicted 812
6 SASI_Hs01_00070208 predicted 2160
7 SASI_Hs01_00070209 predicted 1947
8 SASI_Hs01_00070210 predicted 2091
9 SASI_Hs01_00070211 predicted 3274
10 SASI_Hs01_00070212 predicted 1557
11 SASI_Hs01_00070205 predicted 1917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209954 predicted 3817
2 SASI_Rn02_00209955 predicted 1161
3 SASI_Rn02_00209956 predicted 3684
4 SASI_Rn02_00209957 predicted 1701
5 SASI_Rn02_00209958 predicted 991
6 SASI_Rn02_00209959 predicted 2988
7 SASI_Rn02_00209960 predicted 1815
8 SASI_Rn02_00209961 predicted 2198
9 SASI_Rn02_00209962 predicted 1372
10 SASI_Rn02_00209963 predicted 1151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188499 predicted 2970
2 SASI_Mm01_00188500 predicted 1886
3 SASI_Mm02_00338251 predicted 1735
4 SASI_Mm01_00188501 predicted 1278
5 SASI_Mm01_00188502 predicted 1183
6 SASI_Mm01_00188503 predicted 2222
7 SASI_Mm01_00188505 predicted 1983
8 SASI_Mm01_00188506 predicted 3016
9 SASI_Mm02_00338252 predicted 864
10 SASI_Mm01_00188507 predicted 1943
11 SASI_Mm01_00188504 predicted 1163
12 SASI_Mm01_00188508 predicted 1557
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130448
VALIDATED
PCDH18 MISSION shRNA Bacterial Glycerol Stock
protocadherin 18
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130448.3-4178s21c1
Sequence:CCGGGTTACTGCTTAGCATAGTTAACTCGAGTTAACTATGCTAAGCAGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130448.3-2134s21c1
Sequence:CCGGCCGTTGTGCTGACCATCATTGCTCGAGCAATGATGGTCAGCACAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130448.3-2582s21c1
Sequence:CCGGTGCTGTGTTGCTGGTTATTATCTCGAGATAATAACCAGCAACACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130448.3-575s21c1
Sequence:CCGGATCGGTAATTGCTAGACTATCCTCGAGGATAGTCTAGCAATTACCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130448.3-1239s21c1
Sequence:CCGGACCTTGCTCCTTGATCTAAATCTCGAGATTTAGATCAAGGAGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130448.2-4950s1c1
Sequence:CCGGCGTGTGACAAATGCGAACTTTCTCGAGAAAGTTCGCATTTGTCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130448.2-1537s1c1
Sequence:CCGGCCATTGATACATTCGTTGCTACTCGAGTAGCAACGAATGTATCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130448.2-3052s1c1
Sequence:CCGGCAGGAGATAGTGATTATGATTCTCGAGAATCATAATCACTATCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130448.2-2159s1c1
Sequence:CCGGGCACAATAATACTGCAGAAATCTCGAGATTTCTGCAGTATTATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130448.2-834s1c1
Sequence:CCGGCCCGTCATTCCCATTGAGATACTCGAGTATCTCAATGGGAATGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130448
VALIDATED
PCDH18 MISSION shRNA shRNA Plasmid DNA
protocadherin 18
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130448.3-4178s21c1
Sequence:CCGGGTTACTGCTTAGCATAGTTAACTCGAGTTAACTATGCTAAGCAGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130448.3-2134s21c1
Sequence:CCGGCCGTTGTGCTGACCATCATTGCTCGAGCAATGATGGTCAGCACAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130448.3-2582s21c1
Sequence:CCGGTGCTGTGTTGCTGGTTATTATCTCGAGATAATAACCAGCAACACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130448.3-575s21c1
Sequence:CCGGATCGGTAATTGCTAGACTATCCTCGAGGATAGTCTAGCAATTACCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130448.3-1239s21c1
Sequence:CCGGACCTTGCTCCTTGATCTAAATCTCGAGATTTAGATCAAGGAGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130448.2-4950s1c1
Sequence:CCGGCGTGTGACAAATGCGAACTTTCTCGAGAAAGTTCGCATTTGTCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130448.2-1537s1c1
Sequence:CCGGCCATTGATACATTCGTTGCTACTCGAGTAGCAACGAATGTATCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130448.2-3052s1c1
Sequence:CCGGCAGGAGATAGTGATTATGATTCTCGAGAATCATAATCACTATCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130448.2-2159s1c1
Sequence:CCGGGCACAATAATACTGCAGAAATCTCGAGATTTCTGCAGTATTATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130448.2-834s1c1
Sequence:CCGGCCCGTCATTCCCATTGAGATACTCGAGTATCTCAATGGGAATGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130448
VALIDATED
PCDH18 MISSION shRNA Lentiviral Transduction Particles
protocadherin 18
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130448.3-4178s21c1
Sequence:CCGGGTTACTGCTTAGCATAGTTAACTCGAGTTAACTATGCTAAGCAGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130448.3-2134s21c1
Sequence:CCGGCCGTTGTGCTGACCATCATTGCTCGAGCAATGATGGTCAGCACAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130448.3-2582s21c1
Sequence:CCGGTGCTGTGTTGCTGGTTATTATCTCGAGATAATAACCAGCAACACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130448.3-575s21c1
Sequence:CCGGATCGGTAATTGCTAGACTATCCTCGAGGATAGTCTAGCAATTACCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130448.3-1239s21c1
Sequence:CCGGACCTTGCTCCTTGATCTAAATCTCGAGATTTAGATCAAGGAGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130448.2-4950s1c1
Sequence:CCGGCGTGTGACAAATGCGAACTTTCTCGAGAAAGTTCGCATTTGTCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130448.2-1537s1c1
Sequence:CCGGCCATTGATACATTCGTTGCTACTCGAGTAGCAACGAATGTATCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130448.2-3052s1c1
Sequence:CCGGCAGGAGATAGTGATTATGATTCTCGAGAATCATAATCACTATCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130448.2-2159s1c1
Sequence:CCGGGCACAATAATACTGCAGAAATCTCGAGATTTCTGCAGTATTATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130448.2-834s1c1
Sequence:CCGGCCCGTCATTCCCATTGAGATACTCGAGTATCTCAATGGGAATGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019035
VALIDATED
PCDH18 MISSION shRNA Bacterial Glycerol Stock
protocadherin 18
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019035.2-4754s1c1
Sequence:CCGGCCTCTCACAATACTTGAACATCTCGAGATGTTCAAGTATTGTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019035.2-2130s1c1
Sequence:CCGGGCGTAATAATACGGCAGAAATCTCGAGATTTCTGCCGTATTATTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019035.2-2827s1c1
Sequence:CCGGCCAGAGAATTTCTCATTAGAACTCGAGTTCTAATGAGAAATTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019035.2-1378s1c1
Sequence:CCGGCCAAATTCAATCCCAGCCCATCTCGAGATGGGCTGGGATTGAATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019035.2-2968s1c1
Sequence:CCGGGCCCTTCAAGACATGGACAAACTCGAGTTTGTCCATGTCTTGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019035
VALIDATED
PCDH18 MISSION shRNA shRNA Plasmid DNA
protocadherin 18
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019035.2-4754s1c1
Sequence:CCGGCCTCTCACAATACTTGAACATCTCGAGATGTTCAAGTATTGTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019035.2-2130s1c1
Sequence:CCGGGCGTAATAATACGGCAGAAATCTCGAGATTTCTGCCGTATTATTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019035.2-2827s1c1
Sequence:CCGGCCAGAGAATTTCTCATTAGAACTCGAGTTCTAATGAGAAATTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019035.2-1378s1c1
Sequence:CCGGCCAAATTCAATCCCAGCCCATCTCGAGATGGGCTGGGATTGAATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019035.2-2968s1c1
Sequence:CCGGGCCCTTCAAGACATGGACAAACTCGAGTTTGTCCATGTCTTGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019035
VALIDATED
PCDH18 MISSION shRNA Lentiviral Transduction Particles
protocadherin 18
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019035.2-4754s1c1
Sequence:CCGGCCTCTCACAATACTTGAACATCTCGAGATGTTCAAGTATTGTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019035.2-2130s1c1
Sequence:CCGGGCGTAATAATACGGCAGAAATCTCGAGATTTCTGCCGTATTATTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019035.2-2827s1c1
Sequence:CCGGCCAGAGAATTTCTCATTAGAACTCGAGTTCTAATGAGAAATTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019035.2-1378s1c1
Sequence:CCGGCCAAATTCAATCCCAGCCCATCTCGAGATGGGCTGGGATTGAATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019035.2-2968s1c1
Sequence:CCGGGCCCTTCAAGACATGGACAAACTCGAGTTTGTCCATGTCTTGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)