EMAIL THIS PAGE TO A FRIEND

PCDH19

protocadherin 19

93 Gene Product Result for
Synonyms: EFMR EIEE9
UniProtKB ID: Q8TAB3, B0LDS4, Q5JTG1, Q5JTG2, Q68DT7, Q9P2N3
Gene ID:
Human(57526) Summary: The protein encoded by this gene is a member of the delta-2 protocadherin subclass of the cadherin superfamily. The encoded protein is thought to be a calcium-dependent cell-adhesion protein that is primarily expressed in the brain. Defects in this gene are a cause of epilepsy female-restricted with mental retardation (EFMR). Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
Mouse(279653) protocadherin 19
Rat(317183) protocadherin 19
Zebrafish(555688) protocadherin 19
chicken(422263) protocadherin 19
dog(492013) protocadherin 19
Horse(100059478) protocadherin 19
domestic cat(101084175) protocadherin 19
naked mole-rat(101722572) protocadherin 19
cow(524109) protocadherin 19
sheep(101101961) protocadherin 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020766 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020766 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020766 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001105245 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001105245 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001105245 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105243 Rosetta Predictions human pricing
NM_020766 Rosetta Predictions human pricing
XM_001067802 Rosetta Predictions rat pricing
XM_228429 Rosetta Predictions rat pricing
NM_001105245 Rosetta Predictions mouse pricing
NM_001105246 Rosetta Predictions mouse pricing
XM_205287 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324034 predicted 2849
2 SASI_Hs02_00324035 predicted 4958
3 SASI_Hs02_00324036 predicted 3751
4 SASI_Hs02_00324037 predicted 2923
5 SASI_Hs02_00324038 predicted 4978
6 SASI_Hs02_00324039 predicted 2008
7 SASI_Hs02_00324040 predicted 2862
8 SASI_Hs02_00324041 predicted 4965
9 SASI_Hs02_00324042 predicted 4875
10 SASI_Hs02_00324043 predicted 4955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353893 predicted 2848
2 SASI_Hs01_00160333 predicted 4949
3 SASI_Hs01_00160334 predicted 3751
4 SASI_Hs02_00353894 predicted 2917
5 SASI_Hs01_00160338 predicted 4968
6 SASI_Hs02_00353895 predicted 2009
7 SASI_Hs02_00353896 predicted 2859
8 SASI_Hs01_00160342 predicted 4959
9 SASI_Hs02_00353897 predicted 4874
10 SASI_Hs02_00353898 predicted 4956
11 SASI_Hs01_00160335 predicted 581
12 SASI_Hs01_00160336 predicted 1063
13 SASI_Hs01_00160337 predicted 1265
14 SASI_Hs01_00160339 predicted 652
15 SASI_Hs01_00160340 predicted 1141
16 SASI_Hs01_00160341 predicted 1291
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322358 predicted 4272
2 SASI_Rn02_00322359 predicted 5123
3 SASI_Rn02_00322360 predicted 2228
4 SASI_Rn02_00322361 predicted 3178
5 SASI_Rn02_00322362 predicted 3347
6 SASI_Rn02_00322363 predicted 3275
7 SASI_Rn02_00322364 predicted 3374
8 SASI_Rn02_00322365 predicted 3721
9 SASI_Rn02_00322366 predicted 2637
10 SASI_Rn02_00322367 predicted 2446
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228429 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385052 predicted 4313
2 SASI_Rn02_00385053 predicted 5162
3 SASI_Rn02_00385054 predicted 2272
4 SASI_Rn02_00385055 predicted 3214
5 SASI_Rn02_00385056 predicted 3387
6 SASI_Rn02_00385057 predicted 3314
7 SASI_Rn02_00385058 predicted 3421
8 SASI_Rn02_00385059 predicted 3769
9 SASI_Rn02_00385060 predicted 2687
10 SASI_Rn02_00385061 predicted 2490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303965 predicted 2327
2 SASI_Mm02_00303966 predicted 2540
3 SASI_Mm02_00303967 predicted 3475
4 SASI_Mm02_00303968 predicted 2906
5 SASI_Mm02_00303969 predicted 2066
6 SASI_Mm02_00303970 predicted 4897
7 SASI_Mm02_00303971 predicted 1744
8 SASI_Mm02_00303972 predicted 5136
9 SASI_Mm02_00303973 predicted 2913
10 SASI_Mm02_00303974 predicted 4690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303975 predicted 2331
2 SASI_Mm02_00303976 predicted 2545
3 SASI_Mm02_00303977 predicted 3474
4 SASI_Mm02_00303978 predicted 2905
5 SASI_Mm02_00303979 predicted 2064
6 SASI_Mm02_00303980 predicted 4754
7 SASI_Mm02_00303981 predicted 1751
8 SASI_Mm02_00303982 predicted 4993
9 SASI_Mm02_00303983 predicted 2914
10 SASI_Mm02_00303984 predicted 4542
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_205287 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209085 predicted 2336
2 SASI_Mm01_00209086 predicted 4383
3 SASI_Mm01_00209087 predicted 2554
4 SASI_Mm01_00209088 predicted 3476
5 SASI_Mm01_00209089 predicted 2909
6 SASI_Mm01_00209090 predicted 4900
7 SASI_Mm01_00209091 predicted 2924
8 SASI_Mm01_00209092 predicted 1792
9 SASI_Mm01_00209093 predicted 3826
10 SASI_Mm01_00209094 predicted 3504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020766
PCDH19 MISSION shRNA Bacterial Glycerol Stock
protocadherin 19
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020766.2-2569s21c1
Sequence:CCGGTCACTGTCACTGGCGCTTTAGCTCGAGCTAAAGCGCCAGTGACAGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020766.2-2002s21c1
Sequence:CCGGCAATGGAAATCTGCGTGATAACTCGAGTTATCACGCAGATTTCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020766.2-4168s21c1
Sequence:CCGGTTGACTCCAACTACGTGAATACTCGAGTATTCACGTAGTTGGAGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020766.1-5307s1c1
Sequence:CCGGCCGGGTAATAAGACCCTTATTCTCGAGAATAAGGGTCTTATTACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020766.1-1377s1c1
Sequence:CCGGGAACATCATCGCGCTGTCTATCTCGAGATAGACAGCGCGATGATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020766.1-179s1c1
Sequence:CCGGCCTCATTGCAAAGCAACGCTACTCGAGTAGCGTTGCTTTGCAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020766.1-630s1c1
Sequence:CCGGCCTCTTTGTAACTATGATCTTCTCGAGAAGATCATAGTTACAAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020766.1-1648s1c1
Sequence:CCGGCCTTCCGTGTCTTACACCATTCTCGAGAATGGTGTAAGACACGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020766
PCDH19 MISSION shRNA shRNA Plasmid DNA
protocadherin 19
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020766.2-2569s21c1
Sequence:CCGGTCACTGTCACTGGCGCTTTAGCTCGAGCTAAAGCGCCAGTGACAGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020766.2-2002s21c1
Sequence:CCGGCAATGGAAATCTGCGTGATAACTCGAGTTATCACGCAGATTTCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020766.2-4168s21c1
Sequence:CCGGTTGACTCCAACTACGTGAATACTCGAGTATTCACGTAGTTGGAGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020766.1-5307s1c1
Sequence:CCGGCCGGGTAATAAGACCCTTATTCTCGAGAATAAGGGTCTTATTACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020766.1-1377s1c1
Sequence:CCGGGAACATCATCGCGCTGTCTATCTCGAGATAGACAGCGCGATGATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020766.1-179s1c1
Sequence:CCGGCCTCATTGCAAAGCAACGCTACTCGAGTAGCGTTGCTTTGCAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020766.1-630s1c1
Sequence:CCGGCCTCTTTGTAACTATGATCTTCTCGAGAAGATCATAGTTACAAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020766.1-1648s1c1
Sequence:CCGGCCTTCCGTGTCTTACACCATTCTCGAGAATGGTGTAAGACACGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020766
PCDH19 MISSION shRNA Lentiviral Transduction Particles
protocadherin 19
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020766.2-2569s21c1
Sequence:CCGGTCACTGTCACTGGCGCTTTAGCTCGAGCTAAAGCGCCAGTGACAGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020766.2-2002s21c1
Sequence:CCGGCAATGGAAATCTGCGTGATAACTCGAGTTATCACGCAGATTTCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020766.2-4168s21c1
Sequence:CCGGTTGACTCCAACTACGTGAATACTCGAGTATTCACGTAGTTGGAGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020766.1-5307s1c1
Sequence:CCGGCCGGGTAATAAGACCCTTATTCTCGAGAATAAGGGTCTTATTACCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020766.1-1377s1c1
Sequence:CCGGGAACATCATCGCGCTGTCTATCTCGAGATAGACAGCGCGATGATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020766.1-179s1c1
Sequence:CCGGCCTCATTGCAAAGCAACGCTACTCGAGTAGCGTTGCTTTGCAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020766.1-630s1c1
Sequence:CCGGCCTCTTTGTAACTATGATCTTCTCGAGAAGATCATAGTTACAAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020766.1-1648s1c1
Sequence:CCGGCCTTCCGTGTCTTACACCATTCTCGAGAATGGTGTAAGACACGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105245
PCDH19 MISSION shRNA Bacterial Glycerol Stock
protocadherin 19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105245.1-3560s21c1
Sequence:CCGGGACCGAGGTTTCTTCGAAATACTCGAGTATTTCGAAGAAACCTCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105245.1-3691s21c1
Sequence:CCGGTTCTGCCCTTGTCCTAATATACTCGAGTATATTAGGACAAGGGCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105245.1-2766s21c1
Sequence:CCGGTCAACCTCCTGTCGGTCAATACTCGAGTATTGACCGACAGGAGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105245.1-9977s21c1
Sequence:CCGGCAGTCTCTGTTGCTGATTATACTCGAGTATAATCAGCAACAGAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105245.1-3494s21c1
Sequence:CCGGGTAGTTAAGGCAGACGATTATCTCGAGATAATCGTCTGCCTTAACTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105245
PCDH19 MISSION shRNA shRNA Plasmid DNA
protocadherin 19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105245.1-3560s21c1
Sequence:CCGGGACCGAGGTTTCTTCGAAATACTCGAGTATTTCGAAGAAACCTCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105245.1-3691s21c1
Sequence:CCGGTTCTGCCCTTGTCCTAATATACTCGAGTATATTAGGACAAGGGCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105245.1-2766s21c1
Sequence:CCGGTCAACCTCCTGTCGGTCAATACTCGAGTATTGACCGACAGGAGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105245.1-9977s21c1
Sequence:CCGGCAGTCTCTGTTGCTGATTATACTCGAGTATAATCAGCAACAGAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105245.1-3494s21c1
Sequence:CCGGGTAGTTAAGGCAGACGATTATCTCGAGATAATCGTCTGCCTTAACTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105245
PCDH19 MISSION shRNA Lentiviral Transduction Particles
protocadherin 19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105245.1-3560s21c1
Sequence:CCGGGACCGAGGTTTCTTCGAAATACTCGAGTATTTCGAAGAAACCTCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105245.1-3691s21c1
Sequence:CCGGTTCTGCCCTTGTCCTAATATACTCGAGTATATTAGGACAAGGGCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105245.1-2766s21c1
Sequence:CCGGTCAACCTCCTGTCGGTCAATACTCGAGTATTGACCGACAGGAGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105245.1-9977s21c1
Sequence:CCGGCAGTCTCTGTTGCTGATTATACTCGAGTATAATCAGCAACAGAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105245.1-3494s21c1
Sequence:CCGGGTAGTTAAGGCAGACGATTATCTCGAGATAATCGTCTGCCTTAACTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)