EMAIL THIS PAGE TO A FRIEND

PCDH1

protocadherin 1

130 Gene Product Result for
Synonyms: PC42 PCDH42
UniProtKB ID: Q08174, Q8IUP2
Gene ID:
Human(5097) Summary: This gene belongs to the protocadherin subfamily within the cadherin superfamily. The encoded protein is a membrane protein found at cell-cell boundaries. It is involved in neural cell adhesion, suggesting a possible role in neuronal development. The protein includes an extracelllular region, containing 7 cadherin-like domains, a transmembrane region and a C-terminal cytoplasmic region. Cells expressing the protein showed cell aggregation activity. Alternative splicing occurs in this gene. [provided by RefSeq, Jul 2008]
Mouse(75599) protocadherin 1
Rat(307481) protocadherin 1
cow(509388) protocadherin 1
sheep(101108128) protocadherin 1
naked mole-rat(101712998) protocadherin 1
Domestic Rabbit(100355112) protocadherin 1
Zebrafish(572016) protocadherin 1
chicken(416194) protocadherin 1
domestic cat(101080508) protocadherin 1
Horse(100072165) protocadherin 1
dog(487189) protocadherin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108197 Anti-PCDH1 antibody produced in rabbit affinity isolated antibody mouse, rat, rabbit, dog, horse, pig, human
immunocytochemistry, western blot pricing
SAB2101738 Anti-PCDH1 antibody produced in rabbit affinity isolated antibody, lyophilized powder human, horse, canine, bovine, chicken, rat, rabbit, mouse
western blot pricing
HPA047720 Anti-PCDH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA050538 Anti-PCDH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
SAB1410890 Anti-PCDH1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
WH0005097M1 Monoclonal Anti-PCDH1 antibody produced in mouse clone 5D5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404173 Monoclonal Anti-PCDH1 antibody produced in mouse clone 4H2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409394 Monoclonal Anti-PCDH1 antibody produced in mouse clone 2E8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002587 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002587 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002587 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029357 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029357 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029357 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002587 Rosetta Predictions human pricing
NM_032420 Rosetta Predictions human pricing
XM_001066229 Rosetta Predictions rat pricing
XM_225997 Rosetta Predictions rat pricing
NM_029357 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051867 predicted 2356
2 SASI_Hs01_00051868 predicted 2668
3 SASI_Hs01_00051869 predicted 2377
4 SASI_Hs01_00051870 predicted 849
5 SASI_Hs01_00051871 predicted 2341
6 SASI_Hs01_00051872 predicted 1978
7 SASI_Hs01_00051873 predicted 1158
8 SASI_Hs01_00051874 predicted 2206
9 SASI_Hs01_00051875 predicted 2126
10 SASI_Hs02_00334085 predicted 2131
11 SASI_Hs01_00051876 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359813 predicted 2356
2 SASI_Hs01_00025549 predicted 2661
3 SASI_Hs01_00025550 predicted 2379
4 SASI_Hs01_00025551 predicted 846
5 SASI_Hs01_00025554 predicted 2340
6 SASI_Hs01_00025555 predicted 1982
7 SASI_Hs01_00025556 predicted 1160
8 SASI_Hs02_00359814 predicted 2198
9 SASI_Hs02_00359815 predicted 2127
10 SASI_Hs02_00359816 predicted 2128
11 SASI_Hs01_00025547 predicted 1543
12 SASI_Hs01_00025548 predicted 1531
13 SASI_Hs01_00025552 predicted 1725
14 SASI_Hs01_00025553 predicted 1814
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066229 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316723 predicted 2371
2 SASI_Rn02_00316724 predicted 1285
3 SASI_Rn02_00316725 predicted 2357
4 SASI_Rn02_00316726 predicted 1898
5 SASI_Rn02_00316727 predicted 1074
6 SASI_Rn02_00316728 predicted 909
7 SASI_Rn02_00316729 predicted 2630
8 SASI_Rn02_00316730 predicted 1140
9 SASI_Rn02_00316731 predicted 2227
10 SASI_Rn02_00316732 predicted 2910
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383310 predicted 2558
2 SASI_Rn02_00383311 predicted 1423
3 SASI_Rn02_00383312 predicted 2546
4 SASI_Rn02_00383313 predicted 2043
5 SASI_Rn02_00383314 predicted 1216
6 SASI_Rn02_00383315 predicted 1051
7 SASI_Rn02_00383316 predicted 2817
8 SASI_Rn02_00383317 predicted 1287
9 SASI_Rn02_00383318 predicted 2370
10 SASI_Rn02_00383319 predicted 3110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098293 predicted 2278
2 SASI_Mm01_00098294 predicted 1861
3 SASI_Mm01_00098295 predicted 2386
4 SASI_Mm01_00098296 predicted 1199
5 SASI_Mm01_00098298 predicted 2692
6 SASI_Mm01_00098299 predicted 2820
7 SASI_Mm01_00098300 predicted 2251
8 SASI_Mm01_00098301 predicted 3366
9 SASI_Mm01_00098302 predicted 1778
10 SASI_Mm02_00335222 predicted 1960
11 SASI_Mm01_00098297 predicted 2035
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002587
VALIDATED
PCDH1 MISSION shRNA Bacterial Glycerol Stock
protocadherin 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002587.3-1048s21c1
Sequence:CCGGGCCAATGCAGAAATCGAATACCTCGAGGTATTCGATTTCTGCATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002587.3-924s1c1
Sequence:CCGGCGTGCTTGACACCAATGACAACTCGAGTTGTCATTGGTGTCAAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002587.3-2365s1c1
Sequence:CCGGGCTGAGCTGATCTACAGCATTCTCGAGAATGCTGTAGATCAGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002587.3-2132s1c1
Sequence:CCGGGCTTTGATCGAGAGCAACAAACTCGAGTTTGTTGCTCTCGATCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002587.3-1724s1c1
Sequence:CCGGGCTCTAATGCTGAGCTGGTTTCTCGAGAAACCAGCTCAGCATTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002587.3-2210s21c1
Sequence:CCGGACGTTGGTGTCACCATCAATGCTCGAGCATTGATGGTGACACCAACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002587
VALIDATED
PCDH1 MISSION shRNA shRNA Plasmid DNA
protocadherin 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002587.3-1048s21c1
Sequence:CCGGGCCAATGCAGAAATCGAATACCTCGAGGTATTCGATTTCTGCATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002587.3-924s1c1
Sequence:CCGGCGTGCTTGACACCAATGACAACTCGAGTTGTCATTGGTGTCAAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002587.3-2365s1c1
Sequence:CCGGGCTGAGCTGATCTACAGCATTCTCGAGAATGCTGTAGATCAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002587.3-2132s1c1
Sequence:CCGGGCTTTGATCGAGAGCAACAAACTCGAGTTTGTTGCTCTCGATCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002587.3-1724s1c1
Sequence:CCGGGCTCTAATGCTGAGCTGGTTTCTCGAGAAACCAGCTCAGCATTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002587.3-2210s21c1
Sequence:CCGGACGTTGGTGTCACCATCAATGCTCGAGCATTGATGGTGACACCAACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002587
VALIDATED
PCDH1 MISSION shRNA Lentiviral Transduction Particles
protocadherin 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002587.3-1048s21c1
Sequence:CCGGGCCAATGCAGAAATCGAATACCTCGAGGTATTCGATTTCTGCATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002587.3-924s1c1
Sequence:CCGGCGTGCTTGACACCAATGACAACTCGAGTTGTCATTGGTGTCAAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002587.3-2365s1c1
Sequence:CCGGGCTGAGCTGATCTACAGCATTCTCGAGAATGCTGTAGATCAGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002587.3-2132s1c1
Sequence:CCGGGCTTTGATCGAGAGCAACAAACTCGAGTTTGTTGCTCTCGATCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002587.3-1724s1c1
Sequence:CCGGGCTCTAATGCTGAGCTGGTTTCTCGAGAAACCAGCTCAGCATTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002587.3-2210s21c1
Sequence:CCGGACGTTGGTGTCACCATCAATGCTCGAGCATTGATGGTGACACCAACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029357
VALIDATED
PCDH1 MISSION shRNA Bacterial Glycerol Stock
protocadherin 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029357.3-2066s21c1
Sequence:CCGGGACTGTCATTGACGGAGACAACTCGAGTTGTCTCCGTCAATGACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029357.3-563s21c1
Sequence:CCGGCCTGGAGTTTGAGGTGTCAATCTCGAGATTGACACCTCAAACTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029357.3-3693s21c1
Sequence:CCGGCCAGCTATATAGGTGCTTCTTCTCGAGAAGAAGCACCTATATAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029357.2-1554s1c1
Sequence:CCGGCTCGACTATGAGAAAGTCAAACTCGAGTTTGACTTTCTCATAGTCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029357.2-3693s1c1
Sequence:CCGGCCAGCTATATAGGTGCTTCTTCTCGAGAAGAAGCACCTATATAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029357.2-563s1c1
Sequence:CCGGCCTGGAGTTTGAGGTGTCAATCTCGAGATTGACACCTCAAACTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029357.2-2066s1c1
Sequence:CCGGGACTGTCATTGACGGAGACAACTCGAGTTGTCTCCGTCAATGACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029357.2-2192s1c1
Sequence:CCGGGCAACAGAGTACCTACACCTTCTCGAGAAGGTGTAGGTACTCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029357.3-2192s21c1
Sequence:CCGGGCAACAGAGTACCTACACCTTCTCGAGAAGGTGTAGGTACTCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029357
VALIDATED
PCDH1 MISSION shRNA shRNA Plasmid DNA
protocadherin 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029357.3-2066s21c1
Sequence:CCGGGACTGTCATTGACGGAGACAACTCGAGTTGTCTCCGTCAATGACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029357.3-563s21c1
Sequence:CCGGCCTGGAGTTTGAGGTGTCAATCTCGAGATTGACACCTCAAACTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029357.3-3693s21c1
Sequence:CCGGCCAGCTATATAGGTGCTTCTTCTCGAGAAGAAGCACCTATATAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029357.2-1554s1c1
Sequence:CCGGCTCGACTATGAGAAAGTCAAACTCGAGTTTGACTTTCTCATAGTCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029357.2-3693s1c1
Sequence:CCGGCCAGCTATATAGGTGCTTCTTCTCGAGAAGAAGCACCTATATAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029357.2-563s1c1
Sequence:CCGGCCTGGAGTTTGAGGTGTCAATCTCGAGATTGACACCTCAAACTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029357.2-2066s1c1
Sequence:CCGGGACTGTCATTGACGGAGACAACTCGAGTTGTCTCCGTCAATGACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029357.2-2192s1c1
Sequence:CCGGGCAACAGAGTACCTACACCTTCTCGAGAAGGTGTAGGTACTCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029357.3-2192s21c1
Sequence:CCGGGCAACAGAGTACCTACACCTTCTCGAGAAGGTGTAGGTACTCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029357
VALIDATED
PCDH1 MISSION shRNA Lentiviral Transduction Particles
protocadherin 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029357.3-2066s21c1
Sequence:CCGGGACTGTCATTGACGGAGACAACTCGAGTTGTCTCCGTCAATGACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029357.3-563s21c1
Sequence:CCGGCCTGGAGTTTGAGGTGTCAATCTCGAGATTGACACCTCAAACTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029357.3-3693s21c1
Sequence:CCGGCCAGCTATATAGGTGCTTCTTCTCGAGAAGAAGCACCTATATAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029357.2-1554s1c1
Sequence:CCGGCTCGACTATGAGAAAGTCAAACTCGAGTTTGACTTTCTCATAGTCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029357.2-3693s1c1
Sequence:CCGGCCAGCTATATAGGTGCTTCTTCTCGAGAAGAAGCACCTATATAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029357.2-563s1c1
Sequence:CCGGCCTGGAGTTTGAGGTGTCAATCTCGAGATTGACACCTCAAACTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029357.2-2066s1c1
Sequence:CCGGGACTGTCATTGACGGAGACAACTCGAGTTGTCTCCGTCAATGACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029357.2-2192s1c1
Sequence:CCGGGCAACAGAGTACCTACACCTTCTCGAGAAGGTGTAGGTACTCTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029357.3-2192s21c1
Sequence:CCGGGCAACAGAGTACCTACACCTTCTCGAGAAGGTGTAGGTACTCTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)