EMAIL THIS PAGE TO A FRIEND

PCDH20

protocadherin 20

154 Gene Product Result for
Synonyms: PCDH13
UniProtKB ID: Q8N6Y1, B1AQU2, Q8NDN4, Q9NRT9
Gene ID:
Human(64881) Summary: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Although its specific function is undetermined, the cadherin-related neuronal receptor is thought to play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Jul 2008]
Mouse(219257) protocadherin 20
Rat(306081) protocadherin 20
Zebrafish(568796) protocadherin 20
chicken(428063) protocadherin 20
Zebrafish(100007362) protocadherin 20
domestic cat(101097779) protocadherin 20
Horse(100063858) protocadherin 20
dog(485478) protocadherin 20
cow(616023) protocadherin 20
sheep(101119318) protocadherin 20
naked mole-rat(101714830) protocadherin 20
Domestic Rabbit(100345334) protocadherin 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022843 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022843 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022843 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178685 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178685 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178685 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022843 Rosetta Predictions human pricing
NM_001107280 Rosetta Predictions rat pricing
NM_178685 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173306 predicted 1038
2 SASI_Hs02_00356160 predicted 1542
3 SASI_Hs01_00173307 predicted 2105
4 SASI_Hs01_00173308 predicted 1735
5 SASI_Hs01_00173310 predicted 1627
6 SASI_Hs01_00173311 predicted 2760
7 SASI_Hs01_00173312 predicted 2520
8 SASI_Hs02_00356161 predicted 2407
9 SASI_Hs01_00173314 predicted 1254
10 SASI_Hs01_00173315 predicted 733
11 SASI_Hs01_00173309 predicted 2461
12 SASI_Hs01_00173313 predicted 2053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227285 predicted 1239
2 SASI_Rn02_00227286 predicted 2397
3 SASI_Rn02_00227287 predicted 1645
4 SASI_Rn02_00227288 predicted 1075
5 SASI_Rn02_00227289 predicted 2902
6 SASI_Rn02_00227290 predicted 1227
7 SASI_Rn02_00227291 predicted 2133
8 SASI_Rn02_00227292 predicted 1048
9 SASI_Rn02_00227293 predicted 2438
10 SASI_Rn02_00227294 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349162 predicted 1061
2 SASI_Mm01_00117041 predicted 1091
3 SASI_Mm01_00117042 predicted 2827
4 SASI_Mm01_00117044 predicted 2587
5 SASI_Mm01_00117045 predicted 2895
6 SASI_Mm01_00117046 predicted 967
7 SASI_Mm01_00117047 predicted 1177
8 SASI_Mm01_00117048 predicted 2802
9 SASI_Mm01_00117049 predicted 1551
10 SASI_Mm01_00117050 predicted 1620
11 SASI_Mm01_00117043 predicted 1072
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022843
VALIDATED
PCDH20 MISSION shRNA Bacterial Glycerol Stock
protocadherin 20
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022843.3-1595s21c1
Sequence:CCGGACTGCTCTTGTGTCCATTATTCTCGAGAATAATGGACACAAGAGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022843.3-3074s21c1
Sequence:CCGGGTCACAGGGATGGGCATATACCTCGAGGTATATGCCCATCCCTGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022843.3-2870s21c1
Sequence:CCGGACAGTCATGGTGAACCTATTTCTCGAGAAATAGGTTCACCATGACTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022843.3-2358s21c1
Sequence:CCGGATGCTGACGCTGGACGAAATGCTCGAGCATTTCGTCCAGCGTCAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022843.2-1409s1c1
Sequence:CCGGGCCGTTTAGGTTATCACCTTACTCGAGTAAGGTGATAACCTAAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022843.2-2069s1c1
Sequence:CCGGGCTGAGGGCTAAAGTCTCTTTCTCGAGAAAGAGACTTTAGCCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022843.2-2616s1c1
Sequence:CCGGCCGACTCATAGGAAGGTAGAACTCGAGTTCTACCTTCCTATGAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022843.2-803s1c1
Sequence:CCGGCCTAATTGTCATGGGTGCTTTCTCGAGAAAGCACCCATGACAATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022843
VALIDATED
PCDH20 MISSION shRNA shRNA Plasmid DNA
protocadherin 20
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022843.3-1595s21c1
Sequence:CCGGACTGCTCTTGTGTCCATTATTCTCGAGAATAATGGACACAAGAGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022843.3-3074s21c1
Sequence:CCGGGTCACAGGGATGGGCATATACCTCGAGGTATATGCCCATCCCTGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022843.3-2870s21c1
Sequence:CCGGACAGTCATGGTGAACCTATTTCTCGAGAAATAGGTTCACCATGACTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022843.3-2358s21c1
Sequence:CCGGATGCTGACGCTGGACGAAATGCTCGAGCATTTCGTCCAGCGTCAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022843.2-1409s1c1
Sequence:CCGGGCCGTTTAGGTTATCACCTTACTCGAGTAAGGTGATAACCTAAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022843.2-2069s1c1
Sequence:CCGGGCTGAGGGCTAAAGTCTCTTTCTCGAGAAAGAGACTTTAGCCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022843.2-2616s1c1
Sequence:CCGGCCGACTCATAGGAAGGTAGAACTCGAGTTCTACCTTCCTATGAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022843.2-803s1c1
Sequence:CCGGCCTAATTGTCATGGGTGCTTTCTCGAGAAAGCACCCATGACAATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022843
VALIDATED
PCDH20 MISSION shRNA Lentiviral Transduction Particles
protocadherin 20
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022843.3-1595s21c1
Sequence:CCGGACTGCTCTTGTGTCCATTATTCTCGAGAATAATGGACACAAGAGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022843.3-3074s21c1
Sequence:CCGGGTCACAGGGATGGGCATATACCTCGAGGTATATGCCCATCCCTGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022843.3-2870s21c1
Sequence:CCGGACAGTCATGGTGAACCTATTTCTCGAGAAATAGGTTCACCATGACTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022843.3-2358s21c1
Sequence:CCGGATGCTGACGCTGGACGAAATGCTCGAGCATTTCGTCCAGCGTCAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022843.2-1409s1c1
Sequence:CCGGGCCGTTTAGGTTATCACCTTACTCGAGTAAGGTGATAACCTAAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022843.2-2069s1c1
Sequence:CCGGGCTGAGGGCTAAAGTCTCTTTCTCGAGAAAGAGACTTTAGCCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022843.2-2616s1c1
Sequence:CCGGCCGACTCATAGGAAGGTAGAACTCGAGTTCTACCTTCCTATGAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022843.2-803s1c1
Sequence:CCGGCCTAATTGTCATGGGTGCTTTCTCGAGAAAGCACCCATGACAATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178685
PCDH20 MISSION shRNA Bacterial Glycerol Stock
protocadherin 20
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178685.3-2357s1c1
Sequence:CCGGCCCTCAATCTAATATGTCTTACTCGAGTAAGACATATTAGATTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178685.3-1045s1c1
Sequence:CCGGCCATTGGCATAAGTGACATTACTCGAGTAATGTCACTTATGCCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178685.3-2550s1c1
Sequence:CCGGGCCTTGCTTCAGACAGATTATCTCGAGATAATCTGTCTGAAGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178685.3-3256s1c1
Sequence:CCGGGCTCTAATACACCAAGCAGATCTCGAGATCTGCTTGGTGTATTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178685.3-2958s1c1
Sequence:CCGGCCAGTGGATATTTCTAACATTCTCGAGAATGTTAGAAATATCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178685
PCDH20 MISSION shRNA shRNA Plasmid DNA
protocadherin 20
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178685.3-2357s1c1
Sequence:CCGGCCCTCAATCTAATATGTCTTACTCGAGTAAGACATATTAGATTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178685.3-1045s1c1
Sequence:CCGGCCATTGGCATAAGTGACATTACTCGAGTAATGTCACTTATGCCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178685.3-2550s1c1
Sequence:CCGGGCCTTGCTTCAGACAGATTATCTCGAGATAATCTGTCTGAAGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178685.3-3256s1c1
Sequence:CCGGGCTCTAATACACCAAGCAGATCTCGAGATCTGCTTGGTGTATTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178685.3-2958s1c1
Sequence:CCGGCCAGTGGATATTTCTAACATTCTCGAGAATGTTAGAAATATCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178685
PCDH20 MISSION shRNA Lentiviral Transduction Particles
protocadherin 20
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178685.3-2357s1c1
Sequence:CCGGCCCTCAATCTAATATGTCTTACTCGAGTAAGACATATTAGATTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178685.3-1045s1c1
Sequence:CCGGCCATTGGCATAAGTGACATTACTCGAGTAATGTCACTTATGCCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178685.3-2550s1c1
Sequence:CCGGGCCTTGCTTCAGACAGATTATCTCGAGATAATCTGTCTGAAGCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178685.3-3256s1c1
Sequence:CCGGGCTCTAATACACCAAGCAGATCTCGAGATCTGCTTGGTGTATTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178685.3-2958s1c1
Sequence:CCGGCCAGTGGATATTTCTAACATTCTCGAGAATGTTAGAAATATCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)