EMAIL THIS PAGE TO A FRIEND

PCDH7

protocadherin 7

157 Gene Product Result for
Synonyms: BH-Pcdh BHPCDH
UniProtKB ID: O60245, O60246, O60247, Q4W5C4
Gene ID:
Human(5099) Summary: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a protein with an extracellular domain containing 7 cadherin repeats. The gene product is an integral membrane protein that is thought to function in cell-cell recognition and adhesion. Alternative splicing yields isoforms with unique cytoplasmic tails. [provided by RefSeq, Jul 2008]
Mouse(54216) protocadherin 7
Rat(360942) protocadherin 7
chicken(422797) protocadherin 7
domestic cat(101097972) protocadherin 7
Horse(100065979) protocadherin 7
dog(488843) protocadherin 7
naked mole-rat(101720061) protocadherin 7
cow(514537) protocadherin 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002589 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002589 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002589 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002589 Rosetta Predictions human pricing
NM_032456 Rosetta Predictions human pricing
NM_032457 Rosetta Predictions human pricing
NM_001004087 Rosetta Predictions rat pricing
XM_579120 Rosetta Predictions rat pricing
NM_001122758 Rosetta Predictions mouse pricing
NM_018764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120976 predicted 3077
2 SASI_Hs01_00120977 predicted 1298
3 SASI_Hs02_00334089 predicted 3325
4 SASI_Hs01_00120979 predicted 3122
5 SASI_Hs01_00120980 predicted 2553
6 SASI_Hs01_00120981 predicted 3521
7 SASI_Hs01_00120982 predicted 3126
8 SASI_Hs01_00120983 predicted 3271
9 SASI_Hs01_00120985 predicted 3364
10 SASI_Hs02_00334090 predicted 3376
11 SASI_Hs01_00120978 predicted 3529
12 SASI_Hs01_00120984 predicted 3120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039845 predicted 3086
2 SASI_Hs01_00039846 predicted 1299
3 SASI_Hs02_00359891 predicted 3321
4 SASI_Hs01_00039848 predicted 3120
5 SASI_Hs01_00039849 predicted 2549
6 SASI_Hs01_00039850 predicted 3528
7 SASI_Hs01_00039851 predicted 3131
8 SASI_Hs01_00039852 predicted 3266
9 SASI_Hs01_00039854 predicted 3362
10 SASI_Hs02_00359892 predicted 3370
11 SASI_Hs01_00039847 predicted 3526
12 SASI_Hs01_00039853 predicted 3120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066948 predicted 2942
2 SASI_Hs01_00066949 predicted 1298
3 SASI_Hs02_00359893 predicted 3184
4 SASI_Hs01_00066951 predicted 2978
5 SASI_Hs01_00066952 predicted 2413
6 SASI_Hs01_00066953 predicted 3385
7 SASI_Hs01_00066954 predicted 2988
8 SASI_Hs01_00066955 predicted 3133
9 SASI_Hs01_00066957 predicted 3221
10 SASI_Hs02_00359894 predicted 3234
11 SASI_Hs01_00066950 predicted 3382
12 SASI_Hs01_00066956 predicted 2982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061753 predicted 938
2 SASI_Rn01_00061754 predicted 3110
3 SASI_Rn01_00061755 predicted 348
4 SASI_Rn01_00061756 predicted 2706
5 SASI_Rn01_00061757 predicted 2885
6 SASI_Rn02_00198126 predicted 2118
7 SASI_Rn01_00061758 predicted 1503
8 SASI_Rn02_00198127 predicted 2108
9 SASI_Rn01_00061760 predicted 3169
10 SASI_Rn01_00061762 predicted 1551
11 SASI_Rn01_00061759 predicted 2667
12 SASI_Rn01_00061761 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00180970 predicted 1912
2 SASI_Rn01_00180971 predicted 1967
3 SASI_Rn01_00180972 predicted 1918
4 SASI_Rn01_00180973 predicted 2016
5 SASI_Rn01_00180974 predicted 1821
6 SASI_Rn01_00180975 predicted 1498
7 SASI_Rn01_00180976 predicted 1882
8 SASI_Rn01_00180977 predicted 1509
9 SASI_Rn01_00180978 predicted 1776
10 SASI_Rn01_00180979 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309361 predicted 2218
2 SASI_Mm02_00309362 predicted 2987
3 SASI_Mm02_00309363 predicted 1424
4 SASI_Mm02_00309364 predicted 3188
5 SASI_Mm02_00309365 predicted 3094
6 SASI_Mm02_00309366 predicted 2267
7 SASI_Mm02_00309367 predicted 2953
8 SASI_Mm02_00309368 predicted 2310
9 SASI_Mm02_00309369 predicted 1266
10 SASI_Mm02_00309370 predicted 1375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198943 predicted 2214
2 SASI_Mm02_00324073 predicted 2990
3 SASI_Mm01_00198944 predicted 1428
4 SASI_Mm01_00198945 predicted 3191
5 SASI_Mm02_00324074 predicted 3098
6 SASI_Mm02_00324075 predicted 2259
7 SASI_Mm02_00324076 predicted 2958
8 SASI_Mm01_00198948 predicted 2304
9 SASI_Mm01_00198949 predicted 1273
10 SASI_Mm01_00198950 predicted 1377
11 SASI_Mm01_00198946 predicted 4224
12 SASI_Mm01_00198947 predicted 2189
13 SASI_Mm01_00198951 predicted 4201
14 SASI_Mm01_00198952 predicted 2556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018764
VALIDATED
PCDH7 MISSION shRNA Bacterial Glycerol Stock
protocadherin 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018764.2-2982s21c1
Sequence:CCGGACGACAACGACCCTAAGTTTACTCGAGTAAACTTAGGGTCGTTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018764.2-4679s21c1
Sequence:CCGGCTTCATCGACAGTACACTAAACTCGAGTTTAGTGTACTGTCGATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018764.2-2100s21c1
Sequence:CCGGTCAATGGACAGATCGAGTATGCTCGAGCATACTCGATCTGTCCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018764.2-1416s21c1
Sequence:CCGGACTTCGAGGTGTCGGTGATAGCTCGAGCTATCACCGACACCTCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018764.1-3780s1c1
Sequence:CCGGCAGCAGCATGACAAATCTAAACTCGAGTTTAGATTTGTCATGCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018764.1-5105s1c1
Sequence:CCGGCCCTGACCCATGTCTGTATATCTCGAGATATACAGACATGGGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018764.1-3333s1c1
Sequence:CCGGGCGGACTTGAACTACAGCATTCTCGAGAATGCTGTAGTTCAAGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018764.1-2141s1c1
Sequence:CCGGCCAGTTGAGATTCACAGTAATCTCGAGATTACTGTGAATCTCAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018764.1-3660s1c1
Sequence:CCGGGCTGGCATTATGACAGTGATTCTCGAGAATCACTGTCATAATGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018764.2-2316s21c1
Sequence:CCGGACGTTCCCTCCATCGAAATTCCTCGAGGAATTTCGATGGAGGGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018764
VALIDATED
PCDH7 MISSION shRNA shRNA Plasmid DNA
protocadherin 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018764.2-2982s21c1
Sequence:CCGGACGACAACGACCCTAAGTTTACTCGAGTAAACTTAGGGTCGTTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018764.2-4679s21c1
Sequence:CCGGCTTCATCGACAGTACACTAAACTCGAGTTTAGTGTACTGTCGATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018764.2-2100s21c1
Sequence:CCGGTCAATGGACAGATCGAGTATGCTCGAGCATACTCGATCTGTCCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018764.2-1416s21c1
Sequence:CCGGACTTCGAGGTGTCGGTGATAGCTCGAGCTATCACCGACACCTCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018764.1-3780s1c1
Sequence:CCGGCAGCAGCATGACAAATCTAAACTCGAGTTTAGATTTGTCATGCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018764.1-5105s1c1
Sequence:CCGGCCCTGACCCATGTCTGTATATCTCGAGATATACAGACATGGGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018764.1-3333s1c1
Sequence:CCGGGCGGACTTGAACTACAGCATTCTCGAGAATGCTGTAGTTCAAGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018764.1-2141s1c1
Sequence:CCGGCCAGTTGAGATTCACAGTAATCTCGAGATTACTGTGAATCTCAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018764.1-3660s1c1
Sequence:CCGGGCTGGCATTATGACAGTGATTCTCGAGAATCACTGTCATAATGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018764.2-2316s21c1
Sequence:CCGGACGTTCCCTCCATCGAAATTCCTCGAGGAATTTCGATGGAGGGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018764
VALIDATED
PCDH7 MISSION shRNA Lentiviral Transduction Particles
protocadherin 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018764.2-2982s21c1
Sequence:CCGGACGACAACGACCCTAAGTTTACTCGAGTAAACTTAGGGTCGTTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018764.2-4679s21c1
Sequence:CCGGCTTCATCGACAGTACACTAAACTCGAGTTTAGTGTACTGTCGATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018764.2-2100s21c1
Sequence:CCGGTCAATGGACAGATCGAGTATGCTCGAGCATACTCGATCTGTCCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018764.2-1416s21c1
Sequence:CCGGACTTCGAGGTGTCGGTGATAGCTCGAGCTATCACCGACACCTCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018764.1-3780s1c1
Sequence:CCGGCAGCAGCATGACAAATCTAAACTCGAGTTTAGATTTGTCATGCTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018764.1-5105s1c1
Sequence:CCGGCCCTGACCCATGTCTGTATATCTCGAGATATACAGACATGGGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018764.1-3333s1c1
Sequence:CCGGGCGGACTTGAACTACAGCATTCTCGAGAATGCTGTAGTTCAAGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018764.1-2141s1c1
Sequence:CCGGCCAGTTGAGATTCACAGTAATCTCGAGATTACTGTGAATCTCAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018764.1-3660s1c1
Sequence:CCGGGCTGGCATTATGACAGTGATTCTCGAGAATCACTGTCATAATGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018764.2-2316s21c1
Sequence:CCGGACGTTCCCTCCATCGAAATTCCTCGAGGAATTTCGATGGAGGGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002589
VALIDATED
PCDH7 MISSION shRNA Bacterial Glycerol Stock
protocadherin 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002589.2-2214s21c1
Sequence:CCGGCCTTAACATCAAAGACGAGAACTCGAGTTCTCGTCTTTGATGTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002589.2-4105s21c1
Sequence:CCGGGCAGGAGACAACATTTCAATTCTCGAGAATTGAAATGTTGTCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002589.2-4105s1c1
Sequence:CCGGGCAGGAGACAACATTTCAATTCTCGAGAATTGAAATGTTGTCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002589.2-3664s1c1
Sequence:CCGGGCTGGCATTATGACGGTGATTCTCGAGAATCACCGTCATAATGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002589.2-3613s1c1
Sequence:CCGGCCAAGCTATGAAATTAGCAAACTCGAGTTTGCTAATTTCATAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002589.2-1404s1c1
Sequence:CCGGCGTGCTTGACATCAACGACAACTCGAGTTGTCGTTGATGTCAAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002589.2-2214s1c1
Sequence:CCGGCCTTAACATCAAAGACGAGAACTCGAGTTCTCGTCTTTGATGTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002589.2-1404s21c1
Sequence:CCGGCGTGCTTGACATCAACGACAACTCGAGTTGTCGTTGATGTCAAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002589.2-3664s21c1
Sequence:CCGGGCTGGCATTATGACGGTGATTCTCGAGAATCACCGTCATAATGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002589.2-3613s21c1
Sequence:CCGGCCAAGCTATGAAATTAGCAAACTCGAGTTTGCTAATTTCATAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002589
VALIDATED
PCDH7 MISSION shRNA shRNA Plasmid DNA
protocadherin 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002589.2-2214s21c1
Sequence:CCGGCCTTAACATCAAAGACGAGAACTCGAGTTCTCGTCTTTGATGTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002589.2-4105s21c1
Sequence:CCGGGCAGGAGACAACATTTCAATTCTCGAGAATTGAAATGTTGTCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002589.2-4105s1c1
Sequence:CCGGGCAGGAGACAACATTTCAATTCTCGAGAATTGAAATGTTGTCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002589.2-3664s1c1
Sequence:CCGGGCTGGCATTATGACGGTGATTCTCGAGAATCACCGTCATAATGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002589.2-3613s1c1
Sequence:CCGGCCAAGCTATGAAATTAGCAAACTCGAGTTTGCTAATTTCATAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002589.2-1404s1c1
Sequence:CCGGCGTGCTTGACATCAACGACAACTCGAGTTGTCGTTGATGTCAAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002589.2-2214s1c1
Sequence:CCGGCCTTAACATCAAAGACGAGAACTCGAGTTCTCGTCTTTGATGTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002589.2-1404s21c1
Sequence:CCGGCGTGCTTGACATCAACGACAACTCGAGTTGTCGTTGATGTCAAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002589.2-3664s21c1
Sequence:CCGGGCTGGCATTATGACGGTGATTCTCGAGAATCACCGTCATAATGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002589.2-3613s21c1
Sequence:CCGGCCAAGCTATGAAATTAGCAAACTCGAGTTTGCTAATTTCATAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002589
VALIDATED
PCDH7 MISSION shRNA Lentiviral Transduction Particles
protocadherin 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002589.2-2214s21c1
Sequence:CCGGCCTTAACATCAAAGACGAGAACTCGAGTTCTCGTCTTTGATGTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002589.2-4105s21c1
Sequence:CCGGGCAGGAGACAACATTTCAATTCTCGAGAATTGAAATGTTGTCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002589.2-4105s1c1
Sequence:CCGGGCAGGAGACAACATTTCAATTCTCGAGAATTGAAATGTTGTCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002589.2-3664s1c1
Sequence:CCGGGCTGGCATTATGACGGTGATTCTCGAGAATCACCGTCATAATGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002589.2-3613s1c1
Sequence:CCGGCCAAGCTATGAAATTAGCAAACTCGAGTTTGCTAATTTCATAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002589.2-1404s1c1
Sequence:CCGGCGTGCTTGACATCAACGACAACTCGAGTTGTCGTTGATGTCAAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002589.2-2214s1c1
Sequence:CCGGCCTTAACATCAAAGACGAGAACTCGAGTTCTCGTCTTTGATGTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002589.2-1404s21c1
Sequence:CCGGCGTGCTTGACATCAACGACAACTCGAGTTGTCGTTGATGTCAAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002589.2-3664s21c1
Sequence:CCGGGCTGGCATTATGACGGTGATTCTCGAGAATCACCGTCATAATGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002589.2-3613s21c1
Sequence:CCGGCCAAGCTATGAAATTAGCAAACTCGAGTTTGCTAATTTCATAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)