EMAIL THIS PAGE TO A FRIEND

PCDH8

protocadherin 8

121 Gene Product Result for
Synonyms: ARCADLIN PAPC
UniProtKB ID: O95206, B4DMV7, Q5TAN1, Q5TAN2, Q8IYE9, Q96SF1
Gene ID:
Human(5100) Summary: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes an integral membrane protein that is thought to function in cell adhesion in a CNS-specific manner. Unlike classical cadherins, which are generally encoded by 15-17 exons, this gene includes only 3 exons. Notable is the large first exon encoding the extracellular region, including 6 cadherin domains and a transmembrane region. Alternative splicing yields isoforms with unique cytoplasmic tails. [provided by RefSeq, Jul 2008]
Mouse(18530) protocadherin 8
Rat(64865) protocadherin 8
Zebrafish(30456) protocadherin 8
chicken(428065) protocadherin 8
domestic cat(101091586) protocadherin 8
Horse(100061447) protocadherin 8
dog(485469) protocadherin 8
cow(513346) protocadherin 8
sheep(101122119) protocadherin 8
naked mole-rat(101704648) protocadherin 8
Domestic Rabbit(100343395) protocadherin 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021543 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021543 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021543 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002590 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002590 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002590 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU025441 MISSION® esiRNA esiRNA targeting mouse Pcdh8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002590 Rosetta Predictions human pricing
NM_032949 Rosetta Predictions human pricing
NM_022868 Rosetta Predictions rat pricing
NM_001042726 Rosetta Predictions mouse pricing
NM_021543 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211688 predicted 3249
2 SASI_Hs01_00211689 predicted 613
3 SASI_Hs01_00211691 predicted 3273
4 SASI_Hs01_00211692 predicted 3460
5 SASI_Hs02_00334091 predicted 1684
6 SASI_Hs01_00211693 predicted 1569
7 SASI_Hs02_00334092 predicted 389
8 SASI_Hs01_00211694 predicted 2042
9 SASI_Hs02_00334093 predicted 1022
10 SASI_Hs02_00334094 predicted 952
11 SASI_Hs01_00211690 predicted 3482
12 SASI_Hs01_00211695 predicted 363
13 SASI_Hs01_00211696 predicted 3391
14 SASI_Hs01_00211697 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022044 predicted 2952
2 SASI_Hs01_00022045 predicted 614
3 SASI_Hs01_00022047 predicted 2976
4 SASI_Hs01_00022048 predicted 3172
5 SASI_Hs02_00360575 predicted 1680
6 SASI_Hs01_00022049 predicted 1570
7 SASI_Hs02_00360576 predicted 387
8 SASI_Hs01_00022050 predicted 2039
9 SASI_Hs02_00360577 predicted 1024
10 SASI_Hs02_00360578 predicted 946
11 SASI_Hs01_00022046 predicted 3196
12 SASI_Hs01_00022051 predicted 371
13 SASI_Hs01_00022052 predicted 3100
14 SASI_Hs01_00022053 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022868 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117658 predicted 1643
2 SASI_Rn01_00117659 predicted 298
3 SASI_Rn01_00117660 predicted 304
4 SASI_Rn01_00117661 predicted 2460
5 SASI_Rn01_00117662 predicted 928
6 SASI_Rn01_00117663 predicted 1043
7 SASI_Rn01_00117664 predicted 1284
8 SASI_Rn01_00117665 predicted 2439
9 SASI_Rn01_00117667 predicted 819
10 SASI_Rn02_00263605 predicted 2550
11 SASI_Rn01_00117666 predicted 1843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291065 predicted 1820
2 SASI_Mm02_00291066 predicted 268
3 SASI_Mm02_00291067 predicted 2924
4 SASI_Mm02_00291068 predicted 2729
5 SASI_Mm02_00291069 predicted 318
6 SASI_Mm02_00291070 predicted 490
7 SASI_Mm02_00291071 predicted 2011
8 SASI_Mm02_00291072 predicted 1849
9 SASI_Mm02_00291073 predicted 1651
10 SASI_Mm02_00291074 predicted 1947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021543 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152494 predicted 1823
2 SASI_Mm01_00152495 predicted 271
3 SASI_Mm01_00152496 predicted 3217
4 SASI_Mm01_00152498 predicted 3020
5 SASI_Mm01_00152497 predicted 318
6 SASI_Mm01_00152499 predicted 487
7 SASI_Mm01_00152500 predicted 2014
8 SASI_Mm01_00152501 predicted 1852
9 SASI_Mm01_00152503 predicted 1651
10 SASI_Mm02_00326291 predicted 1942
11 SASI_Mm01_00152502 predicted 2354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021543
PCDH8 MISSION shRNA Bacterial Glycerol Stock
protocadherin 8
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000094225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021543.1-260s1c1
Sequence:CCGGGCAGAAGACCTGCACATGAAACTCGAGTTTCATGTGCAGGTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021543.1-2226s1c1
Sequence:CCGGCAACCGTCAGTTTCGTGGTAACTCGAGTTACCACGAAACTGACGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021543.1-153s1c1
Sequence:CCGGCCTTGCAGCTATTTAGTCTTTCTCGAGAAAGACTAAATAGCTGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021543
PCDH8 MISSION shRNA shRNA Plasmid DNA
protocadherin 8
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000094225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021543.1-260s1c1
Sequence:CCGGGCAGAAGACCTGCACATGAAACTCGAGTTTCATGTGCAGGTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021543.1-2226s1c1
Sequence:CCGGCAACCGTCAGTTTCGTGGTAACTCGAGTTACCACGAAACTGACGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021543.1-153s1c1
Sequence:CCGGCCTTGCAGCTATTTAGTCTTTCTCGAGAAAGACTAAATAGCTGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021543
PCDH8 MISSION shRNA Lentiviral Transduction Particles
protocadherin 8
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000094225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021543.1-260s1c1
Sequence:CCGGGCAGAAGACCTGCACATGAAACTCGAGTTTCATGTGCAGGTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021543.1-2226s1c1
Sequence:CCGGCAACCGTCAGTTTCGTGGTAACTCGAGTTACCACGAAACTGACGGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021543.1-153s1c1
Sequence:CCGGCCTTGCAGCTATTTAGTCTTTCTCGAGAAAGACTAAATAGCTGCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002590
PCDH8 MISSION shRNA Bacterial Glycerol Stock
protocadherin 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002590.2-2532s1c1
Sequence:CCGGCGCAAGAAGGAGGTGCGCAAACTCGAGTTTGCGCACCTCCTTCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002590.2-392s1c1
Sequence:CCGGCCGCCTGATGAAGCAATTCAACTCGAGTTGAATTGCTTCATCAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002590.2-3149s1c1
Sequence:CCGGCCAGATGTCAACCTTCTGTAACTCGAGTTACAGAAGGTTGACATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002590.2-2079s1c1
Sequence:CCGGCGCACCGCAAAGGACACGGTTCTCGAGAACCGTGTCCTTTGCGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002590.2-2967s1c1
Sequence:CCGGAGTGATTTCAACGACAGCGATCTCGAGATCGCTGTCGTTGAAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002590.2-3475s21c1
Sequence:CCGGGACCGGTTTCAGTGTTGTATACTCGAGTATACAACACTGAAACCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002590.2-3681s21c1
Sequence:CCGGTTAACCTGTACATTGTGTAATCTCGAGATTACACAATGTACAGGTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002590
PCDH8 MISSION shRNA shRNA Plasmid DNA
protocadherin 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002590.2-2532s1c1
Sequence:CCGGCGCAAGAAGGAGGTGCGCAAACTCGAGTTTGCGCACCTCCTTCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002590.2-392s1c1
Sequence:CCGGCCGCCTGATGAAGCAATTCAACTCGAGTTGAATTGCTTCATCAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002590.2-3149s1c1
Sequence:CCGGCCAGATGTCAACCTTCTGTAACTCGAGTTACAGAAGGTTGACATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002590.2-2079s1c1
Sequence:CCGGCGCACCGCAAAGGACACGGTTCTCGAGAACCGTGTCCTTTGCGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002590.2-2967s1c1
Sequence:CCGGAGTGATTTCAACGACAGCGATCTCGAGATCGCTGTCGTTGAAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002590.2-3475s21c1
Sequence:CCGGGACCGGTTTCAGTGTTGTATACTCGAGTATACAACACTGAAACCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002590.2-3681s21c1
Sequence:CCGGTTAACCTGTACATTGTGTAATCTCGAGATTACACAATGTACAGGTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002590
PCDH8 MISSION shRNA Lentiviral Transduction Particles
protocadherin 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002590.2-2532s1c1
Sequence:CCGGCGCAAGAAGGAGGTGCGCAAACTCGAGTTTGCGCACCTCCTTCTTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002590.2-392s1c1
Sequence:CCGGCCGCCTGATGAAGCAATTCAACTCGAGTTGAATTGCTTCATCAGGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002590.2-3149s1c1
Sequence:CCGGCCAGATGTCAACCTTCTGTAACTCGAGTTACAGAAGGTTGACATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002590.2-2079s1c1
Sequence:CCGGCGCACCGCAAAGGACACGGTTCTCGAGAACCGTGTCCTTTGCGGTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002590.2-2967s1c1
Sequence:CCGGAGTGATTTCAACGACAGCGATCTCGAGATCGCTGTCGTTGAAATCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002590.2-3475s21c1
Sequence:CCGGGACCGGTTTCAGTGTTGTATACTCGAGTATACAACACTGAAACCGGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002590.2-3681s21c1
Sequence:CCGGTTAACCTGTACATTGTGTAATCTCGAGATTACACAATGTACAGGTTAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)