EMAIL THIS PAGE TO A FRIEND

PCDH9

protocadherin 9

220 Gene Product Result for
UniProtKB ID: Q9HC56, A2A6U1, Q5VT83, Q7Z3U0, Q8N3K7
Gene ID:
Human(5101) Summary: This gene encodes a member of the protocadherin family, and cadherin superfamily, of transmembrane proteins containing cadherin domains. These proteins mediate cell adhesion in neural tissues in the presence of calcium. The encoded protein may be involved in signaling at neuronal synaptic junctions. Sharing a characteristic with other protocadherin genes, this gene has a notably large exon that encodes multiple cadherin domains and a transmembrane region. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
Mouse(211712) protocadherin 9
Rat(306091) protocadherin 9
Zebrafish(100004118) protocadherin 9
Horse(100051875) protocadherin 9
domestic cat(101099519) protocadherin 9
dog(476942) protocadherin 9
chicken(418800) protocadherin 9
Domestic Rabbit(100346535) protocadherin 9
naked mole-rat(101716923) protocadherin 9
cow(509935) protocadherin 9
sheep(101120845) protocadherin 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020403 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081377 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081377 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081377 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140851 MISSION® esiRNA esiRNA human PCDH9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020403 Rosetta Predictions human pricing
NM_203487 Rosetta Predictions human pricing
XM_001073608 Rosetta Predictions rat pricing
XM_001073640 Rosetta Predictions rat pricing
XM_001073680 Rosetta Predictions rat pricing
XM_224429 Rosetta Predictions rat pricing
NM_001081377 Rosetta Predictions mouse pricing
XM_902471 Rosetta Predictions mouse pricing
XM_902474 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353387 predicted 3036
2 SASI_Hs01_00019652 predicted 2547
3 SASI_Hs01_00019653 predicted 4218
4 SASI_Hs01_00019655 predicted 1960
5 SASI_Hs01_00019656 predicted 2694
6 SASI_Hs01_00019657 predicted 3964
7 SASI_Hs01_00019658 predicted 1534
8 SASI_Hs01_00019659 predicted 1425
9 SASI_Hs01_00019660 predicted 4271
10 SASI_Hs01_00019661 predicted 1470
11 SASI_Hs01_00019654 predicted 2106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373413 predicted 3036
2 SASI_Hs01_00038573 predicted 2548
3 SASI_Hs01_00038574 predicted 4314
4 SASI_Hs01_00038576 predicted 1964
5 SASI_Hs01_00038577 predicted 2687
6 SASI_Hs01_00038578 predicted 4064
7 SASI_Hs01_00038579 predicted 1532
8 SASI_Hs01_00038580 predicted 1421
9 SASI_Hs01_00038581 predicted 4377
10 SASI_Hs01_00038582 predicted 1470
11 SASI_Hs01_00038575 predicted 2105
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343316 predicted 1728
2 SASI_Rn02_00343317 predicted 2137
3 SASI_Rn02_00343318 predicted 3685
4 SASI_Rn02_00343319 predicted 1555
5 SASI_Rn02_00343320 predicted 1257
6 SASI_Rn02_00343321 predicted 1996
7 SASI_Rn02_00343322 predicted 1233
8 SASI_Rn02_00343323 predicted 2326
9 SASI_Rn02_00343324 predicted 1054
10 SASI_Rn02_00343325 predicted 1599
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343393 predicted 1592
2 SASI_Rn02_00343394 predicted 2007
3 SASI_Rn02_00343395 predicted 3772
4 SASI_Rn02_00343396 predicted 1408
5 SASI_Rn02_00343397 predicted 1120
6 SASI_Rn02_00343398 predicted 1859
7 SASI_Rn02_00343399 predicted 1093
8 SASI_Rn02_00343400 predicted 2181
9 SASI_Rn02_00343401 predicted 916
10 SASI_Rn02_00343402 predicted 1466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343525 predicted 2311
2 SASI_Rn02_00343526 predicted 2720
3 SASI_Rn02_00343527 predicted 4383
4 SASI_Rn02_00343528 predicted 2130
5 SASI_Rn02_00343529 predicted 1840
6 SASI_Rn02_00343530 predicted 2575
7 SASI_Rn02_00343531 predicted 1806
8 SASI_Rn02_00343532 predicted 2903
9 SASI_Rn02_00343533 predicted 1630
10 SASI_Rn02_00343534 predicted 2187
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224429 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381978 predicted 1596
2 SASI_Rn02_00381979 predicted 1998
3 SASI_Rn02_00381980 predicted 3772
4 SASI_Rn02_00381981 predicted 1411
5 SASI_Rn02_00381982 predicted 1116
6 SASI_Rn02_00381983 predicted 1861
7 SASI_Rn02_00381984 predicted 1096
8 SASI_Rn02_00381985 predicted 2179
9 SASI_Rn02_00381986 predicted 916
10 SASI_Rn02_00381987 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297821 predicted 3688
2 SASI_Mm02_00297822 predicted 1594
3 SASI_Mm02_00297823 predicted 3773
4 SASI_Mm02_00297824 predicted 1231
5 SASI_Mm02_00297825 predicted 1407
6 SASI_Mm02_00297826 predicted 929
7 SASI_Mm02_00297827 predicted 2157
8 SASI_Mm02_00297828 predicted 1855
9 SASI_Mm02_00297829 predicted 1033
10 SASI_Mm02_00297830 predicted 2340
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255835 predicted 3595
2 SASI_Mm01_00255836 predicted 1595
3 SASI_Mm01_00255837 predicted 2006
4 SASI_Mm01_00255838 predicted 3772
5 SASI_Mm01_00255839 predicted 1412
6 SASI_Mm01_00255840 predicted 534
7 SASI_Mm01_00255841 predicted 934
8 SASI_Mm01_00255842 predicted 2163
9 SASI_Mm01_00255843 predicted 1860
10 SASI_Mm01_00255844 predicted 2112
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244106 predicted 3514
2 SASI_Mm01_00244107 predicted 1740
3 SASI_Mm01_00244108 predicted 2152
4 SASI_Mm01_00244109 predicted 3692
5 SASI_Mm01_00244110 predicted 1557
6 SASI_Mm01_00244111 predicted 672
7 SASI_Mm01_00244112 predicted 1067
8 SASI_Mm01_00244113 predicted 2302
9 SASI_Mm01_00244114 predicted 2000
10 SASI_Mm01_00244115 predicted 2482
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020403
VALIDATED
PCDH9 MISSION shRNA Bacterial Glycerol Stock
protocadherin 9
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020403.3-1924s1c1
Sequence:CCGGGCGGTATATGACAACCAATATCTCGAGATATTGGTTGTCATATACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020403.3-2395s1c1
Sequence:CCGGCCCAAGTTTACTCATAATCATCTCGAGATGATTATGAGTAAACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020403.3-1435s1c1
Sequence:CCGGCCAGTGTTTAAAGAGGGTCAACTCGAGTTGACCCTCTTTAAACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020403.3-4168s1c1
Sequence:CCGGCGTAAGCAGTATGGCTCCAATCTCGAGATTGGAGCCATACTGCTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020403.3-953s1c1
Sequence:CCGGCCAACAGAATAGACAGAGAAACTCGAGTTTCTCTGTCTATTCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_020403.4-1763s21c1
Sequence:CCGGTATAGACCTCAGGTACATTATCTCGAGATAATGTACCTGAGGTCTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020403.4-2400s21c1
Sequence:CCGGCCCAAGTTTACTCATAATCATCTCGAGATGATTATGAGTAAACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_020403.4-2938s21c1
Sequence:CCGGATCGTTTGGTGGTCAACATAACTCGAGTTATGTTGACCACCAAACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020403.4-1929s21c1
Sequence:CCGGGCGGTATATGACAACCAATATCTCGAGATATTGGTTGTCATATACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_020403.4-4707s21c1
Sequence:CCGGTTTGTGCTGGGACTGCTATACCTCGAGGTATAGCAGTCCCAGCACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020403.4-1727s21c1
Sequence:CCGGCATCAATGTCACCGATGTAAACTCGAGTTTACATCGGTGACATTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020403.4-4309s21c1
Sequence:CCGGAGGCTATATGGGACCTAATAACTCGAGTTATTAGGTCCCATATAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020403
VALIDATED
PCDH9 MISSION shRNA shRNA Plasmid DNA
protocadherin 9
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020403.3-1924s1c1
Sequence:CCGGGCGGTATATGACAACCAATATCTCGAGATATTGGTTGTCATATACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020403.3-2395s1c1
Sequence:CCGGCCCAAGTTTACTCATAATCATCTCGAGATGATTATGAGTAAACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020403.3-1435s1c1
Sequence:CCGGCCAGTGTTTAAAGAGGGTCAACTCGAGTTGACCCTCTTTAAACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020403.3-4168s1c1
Sequence:CCGGCGTAAGCAGTATGGCTCCAATCTCGAGATTGGAGCCATACTGCTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020403.3-953s1c1
Sequence:CCGGCCAACAGAATAGACAGAGAAACTCGAGTTTCTCTGTCTATTCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_020403.4-1763s21c1
Sequence:CCGGTATAGACCTCAGGTACATTATCTCGAGATAATGTACCTGAGGTCTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020403.4-2400s21c1
Sequence:CCGGCCCAAGTTTACTCATAATCATCTCGAGATGATTATGAGTAAACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_020403.4-2938s21c1
Sequence:CCGGATCGTTTGGTGGTCAACATAACTCGAGTTATGTTGACCACCAAACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020403.4-1929s21c1
Sequence:CCGGGCGGTATATGACAACCAATATCTCGAGATATTGGTTGTCATATACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_020403.4-4707s21c1
Sequence:CCGGTTTGTGCTGGGACTGCTATACCTCGAGGTATAGCAGTCCCAGCACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020403.4-1727s21c1
Sequence:CCGGCATCAATGTCACCGATGTAAACTCGAGTTTACATCGGTGACATTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020403.4-4309s21c1
Sequence:CCGGAGGCTATATGGGACCTAATAACTCGAGTTATTAGGTCCCATATAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020403
VALIDATED
PCDH9 MISSION shRNA Lentiviral Transduction Particles
protocadherin 9
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020403.3-1924s1c1
Sequence:CCGGGCGGTATATGACAACCAATATCTCGAGATATTGGTTGTCATATACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020403.3-2395s1c1
Sequence:CCGGCCCAAGTTTACTCATAATCATCTCGAGATGATTATGAGTAAACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020403.3-1435s1c1
Sequence:CCGGCCAGTGTTTAAAGAGGGTCAACTCGAGTTGACCCTCTTTAAACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020403.3-4168s1c1
Sequence:CCGGCGTAAGCAGTATGGCTCCAATCTCGAGATTGGAGCCATACTGCTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020403.3-953s1c1
Sequence:CCGGCCAACAGAATAGACAGAGAAACTCGAGTTTCTCTGTCTATTCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_020403.4-1763s21c1
Sequence:CCGGTATAGACCTCAGGTACATTATCTCGAGATAATGTACCTGAGGTCTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020403.4-2400s21c1
Sequence:CCGGCCCAAGTTTACTCATAATCATCTCGAGATGATTATGAGTAAACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_020403.4-2938s21c1
Sequence:CCGGATCGTTTGGTGGTCAACATAACTCGAGTTATGTTGACCACCAAACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020403.4-1929s21c1
Sequence:CCGGGCGGTATATGACAACCAATATCTCGAGATATTGGTTGTCATATACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_020403.4-4707s21c1
Sequence:CCGGTTTGTGCTGGGACTGCTATACCTCGAGGTATAGCAGTCCCAGCACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020403.4-1727s21c1
Sequence:CCGGCATCAATGTCACCGATGTAAACTCGAGTTTACATCGGTGACATTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020403.4-4309s21c1
Sequence:CCGGAGGCTATATGGGACCTAATAACTCGAGTTATTAGGTCCCATATAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081377
PCDH9 MISSION shRNA Bacterial Glycerol Stock
protocadherin 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081377.1-1863s21c1
Sequence:CCGGTCCCTATTCAGGAGTCATAAACTCGAGTTTATGACTCCTGAATAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081377.1-1071s21c1
Sequence:CCGGCATAGACCTCAGGTACATTATCTCGAGATAATGTACCTGAGGTCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081377.1-4632s21c1
Sequence:CCGGTGACGTAATTAGTACCATTAACTCGAGTTAATGGTACTAATTACGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081377.1-1035s21c1
Sequence:CCGGCATCAATGTCACCGATGTAAACTCGAGTTTACATCGGTGACATTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081377.1-2246s21c1
Sequence:CCGGACCGTCTTGTGGTCAACATAACTCGAGTTATGTTGACCACAAGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081377
PCDH9 MISSION shRNA shRNA Plasmid DNA
protocadherin 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081377.1-1863s21c1
Sequence:CCGGTCCCTATTCAGGAGTCATAAACTCGAGTTTATGACTCCTGAATAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081377.1-1071s21c1
Sequence:CCGGCATAGACCTCAGGTACATTATCTCGAGATAATGTACCTGAGGTCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081377.1-4632s21c1
Sequence:CCGGTGACGTAATTAGTACCATTAACTCGAGTTAATGGTACTAATTACGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081377.1-1035s21c1
Sequence:CCGGCATCAATGTCACCGATGTAAACTCGAGTTTACATCGGTGACATTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081377.1-2246s21c1
Sequence:CCGGACCGTCTTGTGGTCAACATAACTCGAGTTATGTTGACCACAAGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081377
PCDH9 MISSION shRNA Lentiviral Transduction Particles
protocadherin 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081377.1-1863s21c1
Sequence:CCGGTCCCTATTCAGGAGTCATAAACTCGAGTTTATGACTCCTGAATAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081377.1-1071s21c1
Sequence:CCGGCATAGACCTCAGGTACATTATCTCGAGATAATGTACCTGAGGTCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081377.1-4632s21c1
Sequence:CCGGTGACGTAATTAGTACCATTAACTCGAGTTAATGGTACTAATTACGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081377.1-1035s21c1
Sequence:CCGGCATCAATGTCACCGATGTAAACTCGAGTTTACATCGGTGACATTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081377.1-2246s21c1
Sequence:CCGGACCGTCTTGTGGTCAACATAACTCGAGTTATGTTGACCACAAGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)