EMAIL THIS PAGE TO A FRIEND

PCDHA10

protocadherin alpha 10

241 Gene Product Result for
Synonyms: CNR8 CNRN8 CNRS8 CRNR8 PCDH-ALPHA10
UniProtKB ID: Q9Y5I2, A1L493, O75280, Q9NRU2
Gene ID:
Human(56139) Summary: This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Mouse(12943) protocadherin alpha 10
Rat(116778) protocadherin alpha 10
Domestic Rabbit(100348216) protocadherin alpha 10
domestic guinea pig(100714980) protocadherin alpha 10
domestic cat(101092486) protocadherin alpha 10
dog(607253) protocadherin alpha 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
WH0056139M1 Monoclonal Anti-PCDHA10 antibody produced in mouse clone 1F6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018901 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009961 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009961 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009961 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018901 Rosetta Predictions human pricing
NM_031859 Rosetta Predictions human pricing
NM_031860 Rosetta Predictions human pricing
NM_053939 Rosetta Predictions rat pricing
NM_009961 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209506 predicted 413
2 SASI_Hs01_00209507 predicted 926
3 SASI_Hs01_00209509 predicted 683
4 SASI_Hs01_00209510 predicted 815
5 SASI_Hs01_00209512 predicted 944
6 SASI_Hs01_00209513 predicted 730
7 SASI_Hs02_00352326 predicted 807
8 SASI_Hs01_00209514 predicted 485
9 SASI_Hs01_00209515 predicted 649
10 SASI_Hs02_00352327 predicted 822
11 SASI_Hs01_00209508 predicted 934
12 SASI_Hs01_00209511 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126004 predicted 409
2 SASI_Hs01_00126005 predicted 927
3 SASI_Hs01_00126007 predicted 687
4 SASI_Hs01_00126008 predicted 816
5 SASI_Hs01_00126010 predicted 947
6 SASI_Hs01_00126011 predicted 730
7 SASI_Hs02_00358968 predicted 807
8 SASI_Hs01_00126012 predicted 490
9 SASI_Hs01_00126013 predicted 654
10 SASI_Hs02_00358969 predicted 822
11 SASI_Hs01_00126006 predicted 941
12 SASI_Hs01_00126009 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037619 predicted 2189
2 SASI_Hs01_00037620 predicted 2426
3 SASI_Hs01_00037621 predicted 1841
4 SASI_Hs01_00037622 predicted 1907
5 SASI_Hs01_00037623 predicted 408
6 SASI_Hs02_00358970 predicted 927
7 SASI_Hs01_00037624 predicted 2152
8 SASI_Hs01_00037626 predicted 821
9 SASI_Hs01_00037627 predicted 729
10 SASI_Hs01_00037628 predicted 493
11 SASI_Hs01_00037625 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053939 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076409 predicted 3257
2 SASI_Rn01_00076410 predicted 914
3 SASI_Rn01_00076411 predicted 48
4 SASI_Rn01_00076412 predicted 814
5 SASI_Rn01_00076413 predicted 2787
6 SASI_Rn01_00076414 predicted 848
7 SASI_Rn01_00076415 predicted 581
8 SASI_Rn01_00076416 predicted 1012
9 SASI_Rn01_00076417 predicted 506
10 SASI_Rn02_00266895 predicted 1034
11 SASI_Rn01_00076418 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009961 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079095 predicted 3279
2 SASI_Mm01_00079096 predicted 3184
3 SASI_Mm01_00079097 predicted 787
4 SASI_Mm01_00079098 predicted 800
5 SASI_Mm01_00079099 predicted 489
6 SASI_Mm01_00079100 predicted 1035
7 SASI_Mm01_00079101 predicted 1124
8 SASI_Mm01_00079102 predicted 814
9 SASI_Mm01_00079103 predicted 1062
10 SASI_Mm02_00317527 predicted 2923
11 SASI_Mm01_00079104 predicted 2702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018901
PCDHA10 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018901.2-690s21c1
Sequence:CCGGGGTGTTAGATGCCAATGATAACTCGAGTTATCATTGGCATCTAACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018901.2-1031s21c1
Sequence:CCGGATAATTCACCTGAGGTGATTGCTCGAGCAATCACCTCAGGTGAATTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018901.2-718s21c1
Sequence:CCGGATCTTTGACAGACCGGTTTATCTCGAGATAAACCGGTCTGTCAAAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018901.2-433s21c1
Sequence:CCGGAGACTGCTTGACTCTCGATTTCTCGAGAAATCGAGAGTCAAGCAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018901.2-1112s1c1
Sequence:CCGGTCAGCGTTTCTGACCATGATTCTCGAGAATCATGGTCAGAAACGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018901.2-655s1c1
Sequence:CCGGCCTGAATTTACCGGATCTGTTCTCGAGAACAGATCCGGTAAATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018901.2-502s1c1
Sequence:CCGGACTTACAAACTCAGTCCAAATCTCGAGATTTGGACTGAGTTTGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018901.2-917s1c1
Sequence:CCGGCTATTGACTTTGAGGACAGTACTCGAGTACTGTCCTCAAAGTCAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018901.2-853s1c1
Sequence:CCGGCCACCCACGATAAGAAGGAAACTCGAGTTTCCTTCTTATCGTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018901.2-762s21c1
Sequence:CCGGAGTGAACCAAACATTAGTAATCTCGAGATTACTAATGTTTGGTTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018901
PCDHA10 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018901.2-690s21c1
Sequence:CCGGGGTGTTAGATGCCAATGATAACTCGAGTTATCATTGGCATCTAACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018901.2-1031s21c1
Sequence:CCGGATAATTCACCTGAGGTGATTGCTCGAGCAATCACCTCAGGTGAATTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018901.2-718s21c1
Sequence:CCGGATCTTTGACAGACCGGTTTATCTCGAGATAAACCGGTCTGTCAAAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018901.2-433s21c1
Sequence:CCGGAGACTGCTTGACTCTCGATTTCTCGAGAAATCGAGAGTCAAGCAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018901.2-1112s1c1
Sequence:CCGGTCAGCGTTTCTGACCATGATTCTCGAGAATCATGGTCAGAAACGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018901.2-655s1c1
Sequence:CCGGCCTGAATTTACCGGATCTGTTCTCGAGAACAGATCCGGTAAATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018901.2-502s1c1
Sequence:CCGGACTTACAAACTCAGTCCAAATCTCGAGATTTGGACTGAGTTTGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018901.2-917s1c1
Sequence:CCGGCTATTGACTTTGAGGACAGTACTCGAGTACTGTCCTCAAAGTCAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018901.2-853s1c1
Sequence:CCGGCCACCCACGATAAGAAGGAAACTCGAGTTTCCTTCTTATCGTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018901.2-762s21c1
Sequence:CCGGAGTGAACCAAACATTAGTAATCTCGAGATTACTAATGTTTGGTTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018901
PCDHA10 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018901.2-690s21c1
Sequence:CCGGGGTGTTAGATGCCAATGATAACTCGAGTTATCATTGGCATCTAACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018901.2-1031s21c1
Sequence:CCGGATAATTCACCTGAGGTGATTGCTCGAGCAATCACCTCAGGTGAATTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018901.2-718s21c1
Sequence:CCGGATCTTTGACAGACCGGTTTATCTCGAGATAAACCGGTCTGTCAAAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018901.2-433s21c1
Sequence:CCGGAGACTGCTTGACTCTCGATTTCTCGAGAAATCGAGAGTCAAGCAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018901.2-1112s1c1
Sequence:CCGGTCAGCGTTTCTGACCATGATTCTCGAGAATCATGGTCAGAAACGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018901.2-655s1c1
Sequence:CCGGCCTGAATTTACCGGATCTGTTCTCGAGAACAGATCCGGTAAATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018901.2-502s1c1
Sequence:CCGGACTTACAAACTCAGTCCAAATCTCGAGATTTGGACTGAGTTTGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018901.2-917s1c1
Sequence:CCGGCTATTGACTTTGAGGACAGTACTCGAGTACTGTCCTCAAAGTCAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018901.2-853s1c1
Sequence:CCGGCCACCCACGATAAGAAGGAAACTCGAGTTTCCTTCTTATCGTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018901.2-762s21c1
Sequence:CCGGAGTGAACCAAACATTAGTAATCTCGAGATTACTAATGTTTGGTTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009961
PCDHA10 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009961.1-3483s1c1
Sequence:CCGGGCTGGCTATAACATCACTGTACTCGAGTACAGTGATGTTATAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009961.1-613s1c1
Sequence:CCGGCGAGCTTCAGAGCTTCACTTACTCGAGTAAGTGAAGCTCTGAAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009961.1-2629s1c1
Sequence:CCGGCCCGGTGAGTTGCCAGACAAACTCGAGTTTGTCTGGCAACTCACCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009961.1-814s1c1
Sequence:CCGGGAAGGTTCAAATGGTCAAATTCTCGAGAATTTGACCATTTGAACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009961.1-813s1c1
Sequence:CCGGCGAAGGTTCAAATGGTCAAATCTCGAGATTTGACCATTTGAACCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009961
PCDHA10 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009961.1-3483s1c1
Sequence:CCGGGCTGGCTATAACATCACTGTACTCGAGTACAGTGATGTTATAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009961.1-613s1c1
Sequence:CCGGCGAGCTTCAGAGCTTCACTTACTCGAGTAAGTGAAGCTCTGAAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009961.1-2629s1c1
Sequence:CCGGCCCGGTGAGTTGCCAGACAAACTCGAGTTTGTCTGGCAACTCACCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009961.1-814s1c1
Sequence:CCGGGAAGGTTCAAATGGTCAAATTCTCGAGAATTTGACCATTTGAACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009961.1-813s1c1
Sequence:CCGGCGAAGGTTCAAATGGTCAAATCTCGAGATTTGACCATTTGAACCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009961
PCDHA10 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009961.1-3483s1c1
Sequence:CCGGGCTGGCTATAACATCACTGTACTCGAGTACAGTGATGTTATAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009961.1-613s1c1
Sequence:CCGGCGAGCTTCAGAGCTTCACTTACTCGAGTAAGTGAAGCTCTGAAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009961.1-2629s1c1
Sequence:CCGGCCCGGTGAGTTGCCAGACAAACTCGAGTTTGTCTGGCAACTCACCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009961.1-814s1c1
Sequence:CCGGGAAGGTTCAAATGGTCAAATTCTCGAGAATTTGACCATTTGAACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009961.1-813s1c1
Sequence:CCGGCGAAGGTTCAAATGGTCAAATCTCGAGATTTGACCATTTGAACCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)