EMAIL THIS PAGE TO A FRIEND

PCDHA11

protocadherin alpha 11

246 Gene Product Result for
Synonyms: CNR7 CNRN7 CNRS7 CRNR7 PCDH-ALPHA11
UniProtKB ID: Q9Y5I1, B2RN58, O75279
Gene ID:
Human(56138) Summary: This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Mouse(12942) protocadherin alpha 11
Rat(394223) protocadherin alpha 11
chicken(497221) protocadherin alpha 11
dog(607280) protocadherin alpha 11
domestic cat(101092986) protocadherin alpha 11
cow(787381) protocadherin alpha 11
domestic guinea pig(100715544) protocadherin alpha 11
naked mole-rat(101729513) protocadherin alpha 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018902 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009960 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009960 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009960 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018902 Rosetta Predictions human pricing
NM_031861 Rosetta Predictions human pricing
NM_199486 Rosetta Predictions rat pricing
NM_009960 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142421 predicted 1405
2 SASI_Hs01_00142422 predicted 1351
3 SASI_Hs01_00142425 predicted 1471
4 SASI_Hs01_00142426 predicted 1764
5 SASI_Hs02_00352328 predicted 1717
6 SASI_Hs01_00142427 predicted 1747
7 SASI_Hs01_00142429 predicted 1559
8 SASI_Hs01_00142430 predicted 1674
9 SASI_Hs02_00352329 predicted 2729
10 SASI_Hs02_00352330 predicted 1593
11 SASI_Hs01_00142423 predicted 2795
12 SASI_Hs01_00142424 predicted 1575
13 SASI_Hs01_00142428 predicted 1695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182618 predicted 1402
2 SASI_Hs01_00182619 predicted 1356
3 SASI_Hs01_00182622 predicted 1468
4 SASI_Hs01_00182623 predicted 1757
5 SASI_Hs02_00358971 predicted 1714
6 SASI_Hs01_00182624 predicted 1753
7 SASI_Hs01_00182626 predicted 1564
8 SASI_Hs01_00182627 predicted 1682
9 SASI_Hs02_00358972 predicted 2723
10 SASI_Hs02_00358973 predicted 1586
11 SASI_Hs01_00182620 predicted 2795
12 SASI_Hs01_00182621 predicted 1582
13 SASI_Hs01_00182625 predicted 1689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199486 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032045 predicted 781
2 SASI_Rn01_00032046 predicted 798
3 SASI_Rn01_00032047 predicted 998
4 SASI_Rn01_00032049 predicted 1033
5 SASI_Rn01_00032050 predicted 1041
6 SASI_Rn01_00032051 predicted 812
7 SASI_Rn02_00270246 predicted 417
8 SASI_Rn01_00032052 predicted 1802
9 SASI_Rn01_00032053 predicted 1014
10 SASI_Rn02_00270247 predicted 2145
11 SASI_Rn01_00032044 predicted 3172
12 SASI_Rn01_00032048 predicted 2703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153329 predicted 3294
2 SASI_Mm01_00153330 predicted 3196
3 SASI_Mm02_00317524 predicted 856
4 SASI_Mm02_00317525 predicted 807
5 SASI_Mm01_00153332 predicted 1117
6 SASI_Mm01_00153333 predicted 781
7 SASI_Mm01_00153334 predicted 2162
8 SASI_Mm01_00153335 predicted 889
9 SASI_Mm02_00317526 predicted 464
10 SASI_Mm01_00153337 predicted 761
11 SASI_Mm01_00153331 predicted 2715
12 SASI_Mm01_00153336 predicted 402
13 SASI_Mm01_00153338 predicted 1088
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018902
PCDHA11 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018902.3-1661s21c1
Sequence:CCGGACCGAGACGAAGGAGTCAATGCTCGAGCATTGACTCCTTCGTCTCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018902.3-1475s1c1
Sequence:CCGGCGGAACTTAATTTGCTGCTAACTCGAGTTAGCAGCAAATTAAGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018902.3-1713s1c1
Sequence:CCGGGCCCAATGGAAGACACTTATTCTCGAGAATAAGTGTCTTCCATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018902.3-1275s1c1
Sequence:CCGGGCTGCTGATTGCGGAATCTAACTCGAGTTAGATTCCGCAATCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018902.3-3179s1c1
Sequence:CCGGGTCTTCCTCTAGGTCTGAATACTCGAGTATTCAGACCTAGAGGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018902.3-1691s21c1
Sequence:CCGGCATACTCCTTAATGTCAATTACTCGAGTAATTGACATTAAGGAGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018902.3-1408s21c1
Sequence:CCGGACAAATGGTAAGCAGATTAAACTCGAGTTTAATCTGCTTACCATTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018902.3-1576s1c1
Sequence:CCGGCCAGAGTTTGATAAATCAGAACTCGAGTTCTGATTTATCAAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018902.3-1360s21c1
Sequence:CCGGTTGACCTACAGGCTAAGTAAACTCGAGTTTACTTAGCCTGTAGGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018902
PCDHA11 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018902.3-1661s21c1
Sequence:CCGGACCGAGACGAAGGAGTCAATGCTCGAGCATTGACTCCTTCGTCTCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018902.3-1475s1c1
Sequence:CCGGCGGAACTTAATTTGCTGCTAACTCGAGTTAGCAGCAAATTAAGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018902.3-1713s1c1
Sequence:CCGGGCCCAATGGAAGACACTTATTCTCGAGAATAAGTGTCTTCCATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018902.3-1275s1c1
Sequence:CCGGGCTGCTGATTGCGGAATCTAACTCGAGTTAGATTCCGCAATCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018902.3-3179s1c1
Sequence:CCGGGTCTTCCTCTAGGTCTGAATACTCGAGTATTCAGACCTAGAGGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018902.3-1691s21c1
Sequence:CCGGCATACTCCTTAATGTCAATTACTCGAGTAATTGACATTAAGGAGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018902.3-1408s21c1
Sequence:CCGGACAAATGGTAAGCAGATTAAACTCGAGTTTAATCTGCTTACCATTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018902.3-1576s1c1
Sequence:CCGGCCAGAGTTTGATAAATCAGAACTCGAGTTCTGATTTATCAAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018902.3-1360s21c1
Sequence:CCGGTTGACCTACAGGCTAAGTAAACTCGAGTTTACTTAGCCTGTAGGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018902
PCDHA11 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018902.3-1661s21c1
Sequence:CCGGACCGAGACGAAGGAGTCAATGCTCGAGCATTGACTCCTTCGTCTCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018902.3-1475s1c1
Sequence:CCGGCGGAACTTAATTTGCTGCTAACTCGAGTTAGCAGCAAATTAAGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018902.3-1713s1c1
Sequence:CCGGGCCCAATGGAAGACACTTATTCTCGAGAATAAGTGTCTTCCATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018902.3-1275s1c1
Sequence:CCGGGCTGCTGATTGCGGAATCTAACTCGAGTTAGATTCCGCAATCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018902.3-3179s1c1
Sequence:CCGGGTCTTCCTCTAGGTCTGAATACTCGAGTATTCAGACCTAGAGGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018902.3-1691s21c1
Sequence:CCGGCATACTCCTTAATGTCAATTACTCGAGTAATTGACATTAAGGAGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018902.3-1408s21c1
Sequence:CCGGACAAATGGTAAGCAGATTAAACTCGAGTTTAATCTGCTTACCATTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018902.3-1576s1c1
Sequence:CCGGCCAGAGTTTGATAAATCAGAACTCGAGTTCTGATTTATCAAACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018902.3-1360s21c1
Sequence:CCGGTTGACCTACAGGCTAAGTAAACTCGAGTTTACTTAGCCTGTAGGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009960
PCDHA11 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009960.1-4173s1c1
Sequence:CCGGCCACCTTGTTTAGCTTTCCTTCTCGAGAAGGAAAGCTAAACAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009960.1-615s1c1
Sequence:CCGGCCCGGAACTTAATTTGCTATTCTCGAGAATAGCAAATTAAGTTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009960.1-1084s1c1
Sequence:CCGGGCCCAGCCAAATACAGTCATTCTCGAGAATGACTGTATTTGGCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009960.1-719s1c1
Sequence:CCGGCAGTGTTCGATCATTTAGAATCTCGAGATTCTAAATGATCGAACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009960.1-1240s1c1
Sequence:CCGGCGCGAGAGAGTGTCAACTTATCTCGAGATAAGTTGACACTCTCTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009960
PCDHA11 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009960.1-4173s1c1
Sequence:CCGGCCACCTTGTTTAGCTTTCCTTCTCGAGAAGGAAAGCTAAACAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009960.1-615s1c1
Sequence:CCGGCCCGGAACTTAATTTGCTATTCTCGAGAATAGCAAATTAAGTTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009960.1-1084s1c1
Sequence:CCGGGCCCAGCCAAATACAGTCATTCTCGAGAATGACTGTATTTGGCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009960.1-719s1c1
Sequence:CCGGCAGTGTTCGATCATTTAGAATCTCGAGATTCTAAATGATCGAACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009960.1-1240s1c1
Sequence:CCGGCGCGAGAGAGTGTCAACTTATCTCGAGATAAGTTGACACTCTCTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009960
PCDHA11 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009960.1-4173s1c1
Sequence:CCGGCCACCTTGTTTAGCTTTCCTTCTCGAGAAGGAAAGCTAAACAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009960.1-615s1c1
Sequence:CCGGCCCGGAACTTAATTTGCTATTCTCGAGAATAGCAAATTAAGTTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009960.1-1084s1c1
Sequence:CCGGGCCCAGCCAAATACAGTCATTCTCGAGAATGACTGTATTTGGCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009960.1-719s1c1
Sequence:CCGGCAGTGTTCGATCATTTAGAATCTCGAGATTCTAAATGATCGAACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009960.1-1240s1c1
Sequence:CCGGCGCGAGAGAGTGTCAACTTATCTCGAGATAAGTTGACACTCTCTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)