EMAIL THIS PAGE TO A FRIEND

PCDHA12

protocadherin alpha 12

254 Gene Product Result for
Synonyms: PCDH-ALPHA12
UniProtKB ID: Q9UN75, O75278, Q2M1N8
Gene ID:
Human(56137) Summary: This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Mouse(192164) protocadherin alpha 12
Rat(116779) protocadherin alpha 12
sheep(101122858) protocadherin alpha 12
chicken(497222) protocadherin alpha 12
domestic cat(101093237) protocadherin alpha 12
dog(607297) protocadherin alpha 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018903 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138663 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138663 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138663 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018903 Rosetta Predictions human pricing
NM_031864 Rosetta Predictions human pricing
NM_053940 Rosetta Predictions rat pricing
NM_138663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182142 predicted 1252
2 SASI_Hs01_00182143 predicted 1844
3 SASI_Hs01_00182144 predicted 902
4 SASI_Hs01_00182145 predicted 1034
5 SASI_Hs01_00182146 predicted 1071
6 SASI_Hs01_00182147 predicted 1298
7 SASI_Hs01_00182148 predicted 942
8 SASI_Hs01_00182149 predicted 1781
9 SASI_Hs02_00352331 predicted 922
10 SASI_Hs02_00352332 predicted 1483
11 SASI_Hs01_00182150 predicted 1164
12 SASI_Hs01_00182151 predicted 1929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358975 predicted 1245
2 SASI_Hs02_00358976 predicted 1844
3 SASI_Hs02_00358977 predicted 899
4 SASI_Hs02_00358978 predicted 1028
5 SASI_Hs02_00358979 predicted 1068
6 SASI_Hs02_00358980 predicted 1297
7 SASI_Hs02_00358981 predicted 942
8 SASI_Hs02_00358982 predicted 1778
9 SASI_Hs02_00358983 predicted 920
10 SASI_Hs02_00358984 predicted 1475
11 SASI_Hs01_00175116 predicted 1372
12 SASI_Hs01_00175117 predicted 1916
13 SASI_Hs01_00175118 predicted 1884
14 SASI_Hs01_00175119 predicted 1377
15 SASI_Hs01_00175120 predicted 1919
16 SASI_Hs01_00175121 predicted 2006
17 SASI_Hs01_00175122 predicted 1378
18 SASI_Hs01_00175123 predicted 2020
19 SASI_Hs01_00175124 predicted 1375
20 SASI_Hs01_00175125 predicted 1966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053940 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039497 predicted 3172
2 SASI_Rn01_00039498 predicted 541
3 SASI_Rn01_00039499 predicted 560
4 SASI_Rn01_00039501 predicted 2702
5 SASI_Rn02_00266896 predicted 928
6 SASI_Rn01_00039502 predicted 817
7 SASI_Rn02_00266897 predicted 2337
8 SASI_Rn01_00039503 predicted 798
9 SASI_Rn01_00039504 predicted 382
10 SASI_Rn01_00039505 predicted 2113
11 SASI_Rn01_00039500 predicted 1086
12 SASI_Rn01_00039506 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156456 predicted 3297
2 SASI_Mm01_00156457 predicted 3195
3 SASI_Mm02_00339726 predicted 3260
4 SASI_Mm01_00156458 predicted 1013
5 SASI_Mm01_00156460 predicted 570
6 SASI_Mm02_00339727 predicted 1007
7 SASI_Mm02_00339728 predicted 823
8 SASI_Mm02_00339729 predicted 2937
9 SASI_Mm02_00339730 predicted 2124
10 SASI_Mm02_00339731 predicted 870
11 SASI_Mm01_00156459 predicted 611
12 SASI_Mm01_00156461 predicted 2711
13 SASI_Mm01_00156462 predicted 2288
14 SASI_Mm01_00156463 predicted 1194
15 SASI_Mm01_00156464 predicted 784
16 SASI_Mm01_00156465 predicted 768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018903
VALIDATED
PCDHA12 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018903.2-796s21c1
Sequence:CCGGAGGGTCTGTCCAGATTCAAATCTCGAGATTTGAATCTGGACAGACCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018903.2-1140s21c1
Sequence:CCGGTGGAAGTTCTGGACGTGAATGCTCGAGCATTCACGTCCAGAACTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018903.2-901s21c1
Sequence:CCGGCACAAGAGTGATCCAACTAAACTCGAGTTTAGTTGGATCACTCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018903.2-2203s1c1
Sequence:CCGGTCTGGTGGATATTAACGTGTACTCGAGTACACGTTAATATCCACCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018903.2-848s1c1
Sequence:CCGGGCGTTTGATAAGCCCAGCTATCTCGAGATAGCTGGGCTTATCAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018903.2-638s1c1
Sequence:CCGGGCGTTAAGTCTAAATGAGAATCTCGAGATTCTCATTTAGACTTAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018903.2-700s1c1
Sequence:CCGGGCCTGAATTAGTTCTTCGGAACTCGAGTTCCGAAGAACTAATTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018903.2-1092s1c1
Sequence:CCGGCCATTGATAAAGGGATTCCTTCTCGAGAAGGAATCCCTTTATCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018903
VALIDATED
PCDHA12 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018903.2-796s21c1
Sequence:CCGGAGGGTCTGTCCAGATTCAAATCTCGAGATTTGAATCTGGACAGACCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018903.2-1140s21c1
Sequence:CCGGTGGAAGTTCTGGACGTGAATGCTCGAGCATTCACGTCCAGAACTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018903.2-901s21c1
Sequence:CCGGCACAAGAGTGATCCAACTAAACTCGAGTTTAGTTGGATCACTCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018903.2-2203s1c1
Sequence:CCGGTCTGGTGGATATTAACGTGTACTCGAGTACACGTTAATATCCACCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018903.2-848s1c1
Sequence:CCGGGCGTTTGATAAGCCCAGCTATCTCGAGATAGCTGGGCTTATCAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018903.2-638s1c1
Sequence:CCGGGCGTTAAGTCTAAATGAGAATCTCGAGATTCTCATTTAGACTTAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018903.2-700s1c1
Sequence:CCGGGCCTGAATTAGTTCTTCGGAACTCGAGTTCCGAAGAACTAATTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018903.2-1092s1c1
Sequence:CCGGCCATTGATAAAGGGATTCCTTCTCGAGAAGGAATCCCTTTATCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018903
VALIDATED
PCDHA12 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018903.2-796s21c1
Sequence:CCGGAGGGTCTGTCCAGATTCAAATCTCGAGATTTGAATCTGGACAGACCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018903.2-1140s21c1
Sequence:CCGGTGGAAGTTCTGGACGTGAATGCTCGAGCATTCACGTCCAGAACTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018903.2-901s21c1
Sequence:CCGGCACAAGAGTGATCCAACTAAACTCGAGTTTAGTTGGATCACTCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018903.2-2203s1c1
Sequence:CCGGTCTGGTGGATATTAACGTGTACTCGAGTACACGTTAATATCCACCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018903.2-848s1c1
Sequence:CCGGGCGTTTGATAAGCCCAGCTATCTCGAGATAGCTGGGCTTATCAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018903.2-638s1c1
Sequence:CCGGGCGTTAAGTCTAAATGAGAATCTCGAGATTCTCATTTAGACTTAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018903.2-700s1c1
Sequence:CCGGGCCTGAATTAGTTCTTCGGAACTCGAGTTCCGAAGAACTAATTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018903.2-1092s1c1
Sequence:CCGGCCATTGATAAAGGGATTCCTTCTCGAGAAGGAATCCCTTTATCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138663
PCDHA12 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138663.2-730s1c1
Sequence:CCGGCGGTTCGTTTACAAAGTTAAACTCGAGTTTAACTTTGTAAACGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138663.2-445s1c1
Sequence:CCGGGAAACTAGATTTCCACTAGATCTCGAGATCTAGTGGAAATCTAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138663.2-3541s1c1
Sequence:CCGGGCCAGCAGTTCAAGCGTTTAACTCGAGTTAAACGCTTGAACTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138663.2-719s1c1
Sequence:CCGGCGGAGTTTGATCGGTTCGTTTCTCGAGAAACGAACCGATCAAACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138663.2-2023s1c1
Sequence:CCGGGCACCCAAGATATCTTCCCTTCTCGAGAAGGGAAGATATCTTGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138663
PCDHA12 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138663.2-730s1c1
Sequence:CCGGCGGTTCGTTTACAAAGTTAAACTCGAGTTTAACTTTGTAAACGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138663.2-445s1c1
Sequence:CCGGGAAACTAGATTTCCACTAGATCTCGAGATCTAGTGGAAATCTAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138663.2-3541s1c1
Sequence:CCGGGCCAGCAGTTCAAGCGTTTAACTCGAGTTAAACGCTTGAACTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138663.2-719s1c1
Sequence:CCGGCGGAGTTTGATCGGTTCGTTTCTCGAGAAACGAACCGATCAAACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138663.2-2023s1c1
Sequence:CCGGGCACCCAAGATATCTTCCCTTCTCGAGAAGGGAAGATATCTTGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138663
PCDHA12 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138663.2-730s1c1
Sequence:CCGGCGGTTCGTTTACAAAGTTAAACTCGAGTTTAACTTTGTAAACGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138663.2-445s1c1
Sequence:CCGGGAAACTAGATTTCCACTAGATCTCGAGATCTAGTGGAAATCTAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138663.2-3541s1c1
Sequence:CCGGGCCAGCAGTTCAAGCGTTTAACTCGAGTTAAACGCTTGAACTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138663.2-719s1c1
Sequence:CCGGCGGAGTTTGATCGGTTCGTTTCTCGAGAAACGAACCGATCAAACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138663.2-2023s1c1
Sequence:CCGGGCACCCAAGATATCTTCCCTTCTCGAGAAGGGAAGATATCTTGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)