EMAIL THIS PAGE TO A FRIEND

PCDHA13

protocadherin alpha 13

219 Gene Product Result for
Synonyms: CNR5 CNRN5 CNRS5 CRNR5 PCDH-ALPHA13
UniProtKB ID: Q9Y5I0, O75277
Gene ID:
Human(56136) Summary: This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Rat(116742) protocadherin alpha 13
dog(487166) protocadherin alpha 13
cow(523226) protocadherin alpha 13
domestic guinea pig(100715830) protocadherin alpha 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018904 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018904 Rosetta Predictions human pricing
NM_031865 Rosetta Predictions human pricing
NM_053934 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045938 predicted 398
2 SASI_Hs01_00045939 predicted 745
3 SASI_Hs01_00045940 predicted 1037
4 SASI_Hs01_00045941 predicted 886
5 SASI_Hs02_00352333 predicted 814
6 SASI_Hs01_00045942 predicted 609
7 SASI_Hs01_00045943 predicted 797
8 SASI_Hs01_00045944 predicted 481
9 SASI_Hs01_00045946 predicted 867
10 SASI_Hs01_00045947 predicted 438
11 SASI_Hs01_00045945 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035235 predicted 392
2 SASI_Hs01_00035236 predicted 741
3 SASI_Hs01_00035237 predicted 1042
4 SASI_Hs01_00035238 predicted 892
5 SASI_Hs02_00358985 predicted 816
6 SASI_Hs01_00035239 predicted 607
7 SASI_Hs01_00035240 predicted 790
8 SASI_Hs01_00035241 predicted 477
9 SASI_Hs01_00035243 predicted 870
10 SASI_Hs01_00035244 predicted 435
11 SASI_Hs01_00035242 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116464 predicted 3168
2 SASI_Rn01_00116465 predicted 582
3 SASI_Rn01_00116466 predicted 564
4 SASI_Rn01_00116467 predicted 2698
5 SASI_Rn01_00116468 predicted 608
6 SASI_Rn01_00116469 predicted 2946
7 SASI_Rn01_00116471 predicted 2944
8 SASI_Rn01_00116472 predicted 2701
9 SASI_Rn01_00116473 predicted 2703
10 SASI_Rn02_00266889 predicted 2641
11 SASI_Rn01_00116470 predicted 1376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018904
PCDHA13 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018904.2-853s21c1
Sequence:CCGGGTATGGCCTGCAGTGGTATATCTCGAGATATACCACTGCAGGCCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018904.2-776s21c1
Sequence:CCGGCATTAGTGATCAAGCTAAATGCTCGAGCATTTAGCTTGATCACTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018904.2-512s21c1
Sequence:CCGGGACTGGATCCCAACGATTATTCTCGAGAATAATCGTTGGGATCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018904.2-2075s1c1
Sequence:CCGGCGCTGGTGGATGTCAATGTTTCTCGAGAAACATTGACATCCACCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018904.2-1097s1c1
Sequence:CCGGGCGCCATTATTGCCCTAATCACTCGAGTGATTAGGGCAATAATGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018904.2-811s1c1
Sequence:CCGGGATGGTACAAATGGAGATATACTCGAGTATATCTCCATTTGTACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018904.2-399s1c1
Sequence:CCGGCCCTGAAAGCAAGAAACGAATCTCGAGATTCGTTTCTTGCTTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018904.2-605s1c1
Sequence:CCGGGAGAGGAAATTCAGGAACATACTCGAGTATGTTCCTGAATTTCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018904
PCDHA13 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018904.2-853s21c1
Sequence:CCGGGTATGGCCTGCAGTGGTATATCTCGAGATATACCACTGCAGGCCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018904.2-776s21c1
Sequence:CCGGCATTAGTGATCAAGCTAAATGCTCGAGCATTTAGCTTGATCACTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018904.2-512s21c1
Sequence:CCGGGACTGGATCCCAACGATTATTCTCGAGAATAATCGTTGGGATCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018904.2-2075s1c1
Sequence:CCGGCGCTGGTGGATGTCAATGTTTCTCGAGAAACATTGACATCCACCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018904.2-1097s1c1
Sequence:CCGGGCGCCATTATTGCCCTAATCACTCGAGTGATTAGGGCAATAATGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018904.2-811s1c1
Sequence:CCGGGATGGTACAAATGGAGATATACTCGAGTATATCTCCATTTGTACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018904.2-399s1c1
Sequence:CCGGCCCTGAAAGCAAGAAACGAATCTCGAGATTCGTTTCTTGCTTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018904.2-605s1c1
Sequence:CCGGGAGAGGAAATTCAGGAACATACTCGAGTATGTTCCTGAATTTCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018904
PCDHA13 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018904.2-853s21c1
Sequence:CCGGGTATGGCCTGCAGTGGTATATCTCGAGATATACCACTGCAGGCCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018904.2-776s21c1
Sequence:CCGGCATTAGTGATCAAGCTAAATGCTCGAGCATTTAGCTTGATCACTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018904.2-512s21c1
Sequence:CCGGGACTGGATCCCAACGATTATTCTCGAGAATAATCGTTGGGATCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018904.2-2075s1c1
Sequence:CCGGCGCTGGTGGATGTCAATGTTTCTCGAGAAACATTGACATCCACCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018904.2-1097s1c1
Sequence:CCGGGCGCCATTATTGCCCTAATCACTCGAGTGATTAGGGCAATAATGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018904.2-811s1c1
Sequence:CCGGGATGGTACAAATGGAGATATACTCGAGTATATCTCCATTTGTACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018904.2-399s1c1
Sequence:CCGGCCCTGAAAGCAAGAAACGAATCTCGAGATTCGTTTCTTGCTTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018904.2-605s1c1
Sequence:CCGGGAGAGGAAATTCAGGAACATACTCGAGTATGTTCCTGAATTTCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)