EMAIL THIS PAGE TO A FRIEND

PCDHA1

protocadherin alpha 1

240 Gene Product Result for
Synonyms: PCDH-ALPHA1
UniProtKB ID: Q9Y5I3, O75288, Q9NRT7
Gene ID:
Human(56147) Summary: This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Mouse(116731) protocadherin alpha 1
Rat(393085) protocadherin alpha 1
chicken(497211) protocadherin alpha 1
domestic cat(101092233) protocadherin alpha 1
cow(100847114) protocadherin alpha 1
sheep(101122108) protocadherin alpha 1
domestic guinea pig(100712773) protocadherin alpha 1
naked mole-rat(101724810) protocadherin alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054072 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054072 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054072 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031410 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018900 Rosetta Predictions human pricing
NM_031410 Rosetta Predictions human pricing
NM_031411 Rosetta Predictions human pricing
NM_199503 Rosetta Predictions rat pricing
NM_054072 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070833 predicted 543
2 SASI_Hs01_00070834 predicted 729
3 SASI_Hs01_00070835 predicted 781
4 SASI_Hs01_00070836 predicted 563
5 SASI_Hs01_00070837 predicted 715
6 SASI_Hs01_00070838 predicted 989
7 SASI_Hs01_00070839 predicted 769
8 SASI_Hs01_00070840 predicted 810
9 SASI_Hs01_00070841 predicted 904
10 SASI_Hs01_00070842 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064830 predicted 544
2 SASI_Hs01_00064831 predicted 733
3 SASI_Hs01_00064832 predicted 776
4 SASI_Hs01_00064833 predicted 557
5 SASI_Hs01_00064834 predicted 710
6 SASI_Hs01_00064835 predicted 987
7 SASI_Hs01_00064836 predicted 774
8 SASI_Hs01_00064837 predicted 813
9 SASI_Hs01_00064838 predicted 903
10 SASI_Hs01_00064839 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151819 predicted 2196
2 SASI_Hs01_00151820 predicted 2426
3 SASI_Hs01_00151821 predicted 543
4 SASI_Hs01_00151822 predicted 1845
5 SASI_Hs01_00151823 predicted 1911
6 SASI_Hs01_00151824 predicted 2160
7 SASI_Hs01_00151825 predicted 733
8 SASI_Hs01_00151826 predicted 784
9 SASI_Hs01_00151827 predicted 559
10 SASI_Hs01_00151828 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037235 predicted 3165
2 SASI_Rn01_00037236 predicted 554
3 SASI_Rn01_00037237 predicted 1048
4 SASI_Rn01_00037238 predicted 732
5 SASI_Rn01_00037239 predicted 680
6 SASI_Rn01_00037240 predicted 612
7 SASI_Rn01_00037241 predicted 2694
8 SASI_Rn01_00037242 predicted 759
9 SASI_Rn01_00037243 predicted 1501
10 SASI_Rn01_00037244 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194905 predicted 3292
2 SASI_Mm01_00194906 predicted 3194
3 SASI_Mm02_00337998 predicted 359
4 SASI_Mm01_00194907 predicted 1013
5 SASI_Mm01_00194908 predicted 616
6 SASI_Mm01_00194909 predicted 909
7 SASI_Mm01_00194910 predicted 566
8 SASI_Mm01_00194911 predicted 1078
9 SASI_Mm01_00194912 predicted 759
10 SASI_Mm02_00337999 predicted 715
11 SASI_Mm01_00194913 predicted 2700
12 SASI_Mm01_00194914 predicted 2327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054072
PCDHA1 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054072.1-4697s1c1
Sequence:CCGGCCGGAATATCAGCTTGTAGAACTCGAGTTCTACAAGCTGATATTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054072.1-42s1c1
Sequence:CCGGGCTCTTGTTCTCGCTTCTGTTCTCGAGAACAGAAGCGAGAACAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054072.1-408s1c1
Sequence:CCGGCGCAGAGCAAAGGATATTTATCTCGAGATAAATATCCTTTGCTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054072.1-2326s1c1
Sequence:CCGGCCAGGTTTGAACATAGCGGAACTCGAGTTCCGCTATGTTCAAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054072.1-1817s1c1
Sequence:CCGGCCTATGAACTACAACCTCCTACTCGAGTAGGAGGTTGTAGTTCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054072
PCDHA1 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054072.1-4697s1c1
Sequence:CCGGCCGGAATATCAGCTTGTAGAACTCGAGTTCTACAAGCTGATATTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054072.1-42s1c1
Sequence:CCGGGCTCTTGTTCTCGCTTCTGTTCTCGAGAACAGAAGCGAGAACAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054072.1-408s1c1
Sequence:CCGGCGCAGAGCAAAGGATATTTATCTCGAGATAAATATCCTTTGCTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054072.1-2326s1c1
Sequence:CCGGCCAGGTTTGAACATAGCGGAACTCGAGTTCCGCTATGTTCAAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054072.1-1817s1c1
Sequence:CCGGCCTATGAACTACAACCTCCTACTCGAGTAGGAGGTTGTAGTTCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054072
PCDHA1 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054072.1-4697s1c1
Sequence:CCGGCCGGAATATCAGCTTGTAGAACTCGAGTTCTACAAGCTGATATTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054072.1-42s1c1
Sequence:CCGGGCTCTTGTTCTCGCTTCTGTTCTCGAGAACAGAAGCGAGAACAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054072.1-408s1c1
Sequence:CCGGCGCAGAGCAAAGGATATTTATCTCGAGATAAATATCCTTTGCTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054072.1-2326s1c1
Sequence:CCGGCCAGGTTTGAACATAGCGGAACTCGAGTTCCGCTATGTTCAAACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054072.1-1817s1c1
Sequence:CCGGCCTATGAACTACAACCTCCTACTCGAGTAGGAGGTTGTAGTTCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031410
PCDHA1 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031410.1-519s1c1
Sequence:CCGGCCCGAGTGATTATTTCTCTTTCTCGAGAAAGAGAAATAATCACTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031410.1-2332s1c1
Sequence:CCGGCCAAGTCTTAACACGTCAGAACTCGAGTTCTGACGTGTTAAGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031410.1-550s1c1
Sequence:CCGGGCAAGTGATGAACTGAGTAAACTCGAGTTTACTCAGTTCATCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031410.1-846s1c1
Sequence:CCGGCAGTGGTATTTCTCGTGACATCTCGAGATGTCACGAGAAATACCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031410.1-2387s1c1
Sequence:CCGGCTGGTAATGTAAGTCCAACTTCTCGAGAAGTTGGACTTACATTACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031410.1-802s21c1
Sequence:CCGGGATGCTGACGAAGGTGTAAATCTCGAGATTTACACCTTCGTCAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031410.1-773s21c1
Sequence:CCGGGAACATTAGTGACCACATTAACTCGAGTTAATGTGGTCACTAATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031410
PCDHA1 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031410.1-519s1c1
Sequence:CCGGCCCGAGTGATTATTTCTCTTTCTCGAGAAAGAGAAATAATCACTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031410.1-2332s1c1
Sequence:CCGGCCAAGTCTTAACACGTCAGAACTCGAGTTCTGACGTGTTAAGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031410.1-550s1c1
Sequence:CCGGGCAAGTGATGAACTGAGTAAACTCGAGTTTACTCAGTTCATCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031410.1-846s1c1
Sequence:CCGGCAGTGGTATTTCTCGTGACATCTCGAGATGTCACGAGAAATACCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031410.1-2387s1c1
Sequence:CCGGCTGGTAATGTAAGTCCAACTTCTCGAGAAGTTGGACTTACATTACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031410.1-802s21c1
Sequence:CCGGGATGCTGACGAAGGTGTAAATCTCGAGATTTACACCTTCGTCAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031410.1-773s21c1
Sequence:CCGGGAACATTAGTGACCACATTAACTCGAGTTAATGTGGTCACTAATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031410
PCDHA1 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031410.1-519s1c1
Sequence:CCGGCCCGAGTGATTATTTCTCTTTCTCGAGAAAGAGAAATAATCACTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031410.1-2332s1c1
Sequence:CCGGCCAAGTCTTAACACGTCAGAACTCGAGTTCTGACGTGTTAAGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031410.1-550s1c1
Sequence:CCGGGCAAGTGATGAACTGAGTAAACTCGAGTTTACTCAGTTCATCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031410.1-846s1c1
Sequence:CCGGCAGTGGTATTTCTCGTGACATCTCGAGATGTCACGAGAAATACCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031410.1-2387s1c1
Sequence:CCGGCTGGTAATGTAAGTCCAACTTCTCGAGAAGTTGGACTTACATTACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031410.1-802s21c1
Sequence:CCGGGATGCTGACGAAGGTGTAAATCTCGAGATTTACACCTTCGTCAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031410.1-773s21c1
Sequence:CCGGGAACATTAGTGACCACATTAACTCGAGTTAATGTGGTCACTAATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)