EMAIL THIS PAGE TO A FRIEND

PCDHA2

protocadherin alpha 2

252 Gene Product Result for
Synonyms: PCDH-ALPHA2
UniProtKB ID: Q9Y5H9, O75287, Q9BTV3
Gene ID:
Human(56146) Summary: This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Mouse(353234) protocadherin alpha 2
Rat(393086) protocadherin alpha 2
chicken(497212) protocadherin alpha 2
dog(487164) protocadherin alpha 2
domestic guinea pig(100713044) protocadherin alpha 2
cow(100847133) protocadherin alpha 2
sheep(101122274) protocadherin alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018905 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198117 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198117 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198117 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU226411 MISSION® esiRNA esiRNA targeting human PCDHA2 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018905 Rosetta Predictions human pricing
NM_031495 Rosetta Predictions human pricing
NM_031496 Rosetta Predictions human pricing
NM_199504 Rosetta Predictions rat pricing
NM_198117 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169593 predicted 874
2 SASI_Hs01_00169594 predicted 885
3 SASI_Hs01_00169595 predicted 713
4 SASI_Hs01_00169596 predicted 514
5 SASI_Hs01_00169597 predicted 930
6 SASI_Hs01_00169599 predicted 866
7 SASI_Hs01_00169600 predicted 1473
8 SASI_Hs01_00169601 predicted 959
9 SASI_Hs01_00169602 predicted 498
10 SASI_Hs02_00352334 predicted 657
11 SASI_Hs01_00169598 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204477 predicted 875
2 SASI_Hs01_00204478 predicted 878
3 SASI_Hs01_00204479 predicted 708
4 SASI_Hs01_00204480 predicted 514
5 SASI_Hs01_00204481 predicted 926
6 SASI_Hs01_00204483 predicted 865
7 SASI_Hs01_00204484 predicted 1477
8 SASI_Hs01_00204485 predicted 965
9 SASI_Hs01_00204486 predicted 504
10 SASI_Hs02_00358934 predicted 660
11 SASI_Hs01_00204482 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044681 predicted 885
2 SASI_Hs01_00044682 predicted 882
3 SASI_Hs01_00044683 predicted 712
4 SASI_Hs01_00044684 predicted 525
5 SASI_Hs01_00044685 predicted 933
6 SASI_Hs01_00044686 predicted 534
7 SASI_Hs01_00044687 predicted 871
8 SASI_Hs01_00044688 predicted 1481
9 SASI_Hs01_00044689 predicted 961
10 SASI_Hs01_00044690 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081495 predicted 3168
2 SASI_Rn01_00081496 predicted 777
3 SASI_Rn02_00270277 predicted 1744
4 SASI_Rn01_00081497 predicted 2312
5 SASI_Rn02_00270278 predicted 821
6 SASI_Rn01_00081498 predicted 2701
7 SASI_Rn01_00081499 predicted 2355
8 SASI_Rn01_00081500 predicted 1032
9 SASI_Rn01_00081501 predicted 745
10 SASI_Rn01_00081503 predicted 937
11 SASI_Rn01_00081502 predicted 1767
12 SASI_Rn01_00081504 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198117 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184465 predicted 3289
2 SASI_Mm01_00184466 predicted 3196
3 SASI_Mm01_00184467 predicted 462
4 SASI_Mm01_00184468 predicted 1119
5 SASI_Mm01_00184469 predicted 2358
6 SASI_Mm02_00350865 predicted 1367
7 SASI_Mm01_00184470 predicted 1983
8 SASI_Mm01_00184472 predicted 733
9 SASI_Mm01_00184473 predicted 556
10 SASI_Mm02_00350866 predicted 807
11 SASI_Mm01_00184471 predicted 2705
12 SASI_Mm01_00184474 predicted 826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018905
PCDHA2 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018905.2-662s21c1
Sequence:CCGGGATGAACTAAGCGAATCTTTGCTCGAGCAAAGATTCGCTTAGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018905.2-716s21c1
Sequence:CCGGGAAACTGCTGAGGTTAATTTGCTCGAGCAAATTAACCTCAGCAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018905.2-777s1c1
Sequence:CCGGGCACCGTTCAAATACTTATTACTCGAGTAATAAGTATTTGAACGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018905.2-534s1c1
Sequence:CCGGCCGAATCAAGGCTGCTTGATTCTCGAGAATCAAGCAGCCTTGATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018905.2-834s1c1
Sequence:CCGGCCCAATCAGTTTACAAAGTAACTCGAGTTACTTTGTAAACTGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018905.2-966s1c1
Sequence:CCGGCCACTATACAGACTAAGTTTACTCGAGTAAACTTAGTCTGTATAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018905.2-2467s1c1
Sequence:CCGGGCTCTCAGAATCAGAATACGTCTCGAGACGTATTCTGATTCTGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018905
PCDHA2 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018905.2-662s21c1
Sequence:CCGGGATGAACTAAGCGAATCTTTGCTCGAGCAAAGATTCGCTTAGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018905.2-716s21c1
Sequence:CCGGGAAACTGCTGAGGTTAATTTGCTCGAGCAAATTAACCTCAGCAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018905.2-777s1c1
Sequence:CCGGGCACCGTTCAAATACTTATTACTCGAGTAATAAGTATTTGAACGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018905.2-534s1c1
Sequence:CCGGCCGAATCAAGGCTGCTTGATTCTCGAGAATCAAGCAGCCTTGATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018905.2-834s1c1
Sequence:CCGGCCCAATCAGTTTACAAAGTAACTCGAGTTACTTTGTAAACTGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018905.2-966s1c1
Sequence:CCGGCCACTATACAGACTAAGTTTACTCGAGTAAACTTAGTCTGTATAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018905.2-2467s1c1
Sequence:CCGGGCTCTCAGAATCAGAATACGTCTCGAGACGTATTCTGATTCTGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018905
PCDHA2 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018905.2-662s21c1
Sequence:CCGGGATGAACTAAGCGAATCTTTGCTCGAGCAAAGATTCGCTTAGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018905.2-716s21c1
Sequence:CCGGGAAACTGCTGAGGTTAATTTGCTCGAGCAAATTAACCTCAGCAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018905.2-777s1c1
Sequence:CCGGGCACCGTTCAAATACTTATTACTCGAGTAATAAGTATTTGAACGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018905.2-534s1c1
Sequence:CCGGCCGAATCAAGGCTGCTTGATTCTCGAGAATCAAGCAGCCTTGATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018905.2-834s1c1
Sequence:CCGGCCCAATCAGTTTACAAAGTAACTCGAGTTACTTTGTAAACTGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018905.2-966s1c1
Sequence:CCGGCCACTATACAGACTAAGTTTACTCGAGTAAACTTAGTCTGTATAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018905.2-2467s1c1
Sequence:CCGGGCTCTCAGAATCAGAATACGTCTCGAGACGTATTCTGATTCTGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198117
PCDHA2 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198117.1-392s1c1
Sequence:CCGGCGCGATTTCCAATGACAGAAACTCGAGTTTCTGTCATTGGAAATCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198117.1-832s1c1
Sequence:CCGGGTGTATTCACTCGGTAGTGATCTCGAGATCACTACCGAGTGAATACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198117.1-2944s1c1
Sequence:CCGGGCCCTCAGAAATCTGCAGAAACTCGAGTTTCTGCAGATTTCTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198117.1-771s1c1
Sequence:CCGGCGGAACCTTAGTGATGAAATTCTCGAGAATTTCATCACTAAGGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198117.1-1984s1c1
Sequence:CCGGGCCACAGTGTTAGTTTCTCTACTCGAGTAGAGAAACTAACACTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198117
PCDHA2 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198117.1-392s1c1
Sequence:CCGGCGCGATTTCCAATGACAGAAACTCGAGTTTCTGTCATTGGAAATCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198117.1-832s1c1
Sequence:CCGGGTGTATTCACTCGGTAGTGATCTCGAGATCACTACCGAGTGAATACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198117.1-2944s1c1
Sequence:CCGGGCCCTCAGAAATCTGCAGAAACTCGAGTTTCTGCAGATTTCTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198117.1-771s1c1
Sequence:CCGGCGGAACCTTAGTGATGAAATTCTCGAGAATTTCATCACTAAGGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198117.1-1984s1c1
Sequence:CCGGGCCACAGTGTTAGTTTCTCTACTCGAGTAGAGAAACTAACACTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198117
PCDHA2 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198117.1-392s1c1
Sequence:CCGGCGCGATTTCCAATGACAGAAACTCGAGTTTCTGTCATTGGAAATCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198117.1-832s1c1
Sequence:CCGGGTGTATTCACTCGGTAGTGATCTCGAGATCACTACCGAGTGAATACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198117.1-2944s1c1
Sequence:CCGGGCCCTCAGAAATCTGCAGAAACTCGAGTTTCTGCAGATTTCTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198117.1-771s1c1
Sequence:CCGGCGGAACCTTAGTGATGAAATTCTCGAGAATTTCATCACTAAGGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198117.1-1984s1c1
Sequence:CCGGGCCACAGTGTTAGTTTCTCTACTCGAGTAGAGAAACTAACACTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)