EMAIL THIS PAGE TO A FRIEND

PCDHA3

protocadherin alpha 3

245 Gene Product Result for
Synonyms: PCDH-ALPHA3
UniProtKB ID: Q9Y5H8, O75286
Gene ID:
Human(56145) Summary: This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Mouse(192163) protocadherin alpha 3
Rat(116780) protocadherin alpha 3
domestic guinea pig(100713314) protocadherin alpha 3
naked mole-rat(101725180) protocadherin alpha 3
Zebrafish(100535181) protocadherin alpha 3
dog(607185) protocadherin alpha 3
chicken(497213) protocadherin alpha 3
Horse(100629863) protocadherin alpha 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018906 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018906 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018906 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138662 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138662 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138662 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103991 MISSION® esiRNA esiRNA human PCDHA3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018906 Rosetta Predictions human pricing
NM_031497 Rosetta Predictions human pricing
NM_053941 Rosetta Predictions rat pricing
NM_138662 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117248 predicted 796
2 SASI_Hs02_00352335 predicted 798
3 SASI_Hs01_00117250 predicted 899
4 SASI_Hs02_00352336 predicted 997
5 SASI_Hs01_00117251 predicted 898
6 SASI_Hs02_00352337 predicted 1059
7 SASI_Hs01_00117252 predicted 826
8 SASI_Hs01_00117253 predicted 1038
9 SASI_Hs01_00117254 predicted 941
10 SASI_Hs01_00117255 predicted 952
11 SASI_Hs01_00117249 predicted 1054
12 SASI_Hs01_00117256 predicted 997
13 SASI_Hs01_00117257 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183210 predicted 797
2 SASI_Hs02_00358935 predicted 796
3 SASI_Hs01_00183212 predicted 903
4 SASI_Hs02_00358936 predicted 994
5 SASI_Hs01_00183213 predicted 898
6 SASI_Hs02_00358937 predicted 1063
7 SASI_Hs01_00183214 predicted 832
8 SASI_Hs01_00183215 predicted 1045
9 SASI_Hs01_00183216 predicted 943
10 SASI_Hs01_00183217 predicted 950
11 SASI_Hs01_00183211 predicted 1049
12 SASI_Hs01_00183218 predicted 988
13 SASI_Hs01_00183219 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053941 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084118 predicted 3145
2 SASI_Rn01_00084119 predicted 2963
3 SASI_Rn01_00084120 predicted 1404
4 SASI_Rn01_00084121 predicted 783
5 SASI_Rn01_00084122 predicted 864
6 SASI_Rn01_00084123 predicted 480
7 SASI_Rn02_00266898 predicted 1027
8 SASI_Rn01_00084124 predicted 2676
9 SASI_Rn01_00084125 predicted 2120
10 SASI_Rn01_00084126 predicted 2293
11 SASI_Rn01_00084127 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136943 predicted 3271
2 SASI_Mm01_00136944 predicted 3176
3 SASI_Mm02_00339723 predicted 3232
4 SASI_Mm01_00136945 predicted 502
5 SASI_Mm01_00136946 predicted 600
6 SASI_Mm01_00136947 predicted 2344
7 SASI_Mm02_00339724 predicted 804
8 SASI_Mm01_00136949 predicted 836
9 SASI_Mm01_00136950 predicted 792
10 SASI_Mm02_00339725 predicted 487
11 SASI_Mm01_00136948 predicted 1920
12 SASI_Mm01_00136951 predicted 2687
13 SASI_Mm01_00136952 predicted 2298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018906
PCDHA3 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018906.2-475s21c1
Sequence:CCGGGATGCAGATATCGGAACAAATCTCGAGATTTGTTCCGATATCTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018906.2-1001s21c1
Sequence:CCGGGCACAGTTCTACTCGAAATTGCTCGAGCAATTTCGAGTAGAACTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018906.2-786s21c1
Sequence:CCGGGACCGTTAACGCCACCGATTTCTCGAGAAATCGGTGGCGTTAACGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018906.2-721s1c1
Sequence:CCGGGCGTTTGAGAGGACGATCTATCTCGAGATAGATCGTCCTCTCAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018906.2-510s1c1
Sequence:CCGGCAGTCTTGATTCCACTGAATACTCGAGTATTCAGTGGAATCAAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018906.2-1086s1c1
Sequence:CCGGCTCTCCACTTAGCACAGTCATCTCGAGATGACTGTGCTAAGTGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018906.2-917s1c1
Sequence:CCGGGTAACATAGATTTCGAGGAAACTCGAGTTTCCTCGAAATCTATGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018906
PCDHA3 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018906.2-475s21c1
Sequence:CCGGGATGCAGATATCGGAACAAATCTCGAGATTTGTTCCGATATCTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018906.2-1001s21c1
Sequence:CCGGGCACAGTTCTACTCGAAATTGCTCGAGCAATTTCGAGTAGAACTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018906.2-786s21c1
Sequence:CCGGGACCGTTAACGCCACCGATTTCTCGAGAAATCGGTGGCGTTAACGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018906.2-721s1c1
Sequence:CCGGGCGTTTGAGAGGACGATCTATCTCGAGATAGATCGTCCTCTCAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018906.2-510s1c1
Sequence:CCGGCAGTCTTGATTCCACTGAATACTCGAGTATTCAGTGGAATCAAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018906.2-1086s1c1
Sequence:CCGGCTCTCCACTTAGCACAGTCATCTCGAGATGACTGTGCTAAGTGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018906.2-917s1c1
Sequence:CCGGGTAACATAGATTTCGAGGAAACTCGAGTTTCCTCGAAATCTATGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018906
PCDHA3 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018906.2-475s21c1
Sequence:CCGGGATGCAGATATCGGAACAAATCTCGAGATTTGTTCCGATATCTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018906.2-1001s21c1
Sequence:CCGGGCACAGTTCTACTCGAAATTGCTCGAGCAATTTCGAGTAGAACTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018906.2-786s21c1
Sequence:CCGGGACCGTTAACGCCACCGATTTCTCGAGAAATCGGTGGCGTTAACGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018906.2-721s1c1
Sequence:CCGGGCGTTTGAGAGGACGATCTATCTCGAGATAGATCGTCCTCTCAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018906.2-510s1c1
Sequence:CCGGCAGTCTTGATTCCACTGAATACTCGAGTATTCAGTGGAATCAAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018906.2-1086s1c1
Sequence:CCGGCTCTCCACTTAGCACAGTCATCTCGAGATGACTGTGCTAAGTGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018906.2-917s1c1
Sequence:CCGGGTAACATAGATTTCGAGGAAACTCGAGTTTCCTCGAAATCTATGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138662
PCDHA3 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138662.1-4008s1c1
Sequence:CCGGGCACTTTGATTACACAACCTTCTCGAGAAGGTTGTGTAATCAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138662.1-837s1c1
Sequence:CCGGCCAGGATATGTCACTTGAAATCTCGAGATTTCAAGTGACATATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138662.1-488s1c1
Sequence:CCGGCGTTGTTGTCTTACAGTCTTACTCGAGTAAGACTGTAAGACAACAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138662.1-876s1c1
Sequence:CCGGAGACCCAATCAGTGGATACATCTCGAGATGTATCCACTGATTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138662.1-1029s1c1
Sequence:CCGGCGTGCCTGAATTGGTCATCAACTCGAGTTGATGACCAATTCAGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138662
PCDHA3 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138662.1-4008s1c1
Sequence:CCGGGCACTTTGATTACACAACCTTCTCGAGAAGGTTGTGTAATCAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138662.1-837s1c1
Sequence:CCGGCCAGGATATGTCACTTGAAATCTCGAGATTTCAAGTGACATATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138662.1-488s1c1
Sequence:CCGGCGTTGTTGTCTTACAGTCTTACTCGAGTAAGACTGTAAGACAACAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138662.1-876s1c1
Sequence:CCGGAGACCCAATCAGTGGATACATCTCGAGATGTATCCACTGATTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138662.1-1029s1c1
Sequence:CCGGCGTGCCTGAATTGGTCATCAACTCGAGTTGATGACCAATTCAGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138662
PCDHA3 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138662.1-4008s1c1
Sequence:CCGGGCACTTTGATTACACAACCTTCTCGAGAAGGTTGTGTAATCAAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138662.1-837s1c1
Sequence:CCGGCCAGGATATGTCACTTGAAATCTCGAGATTTCAAGTGACATATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138662.1-488s1c1
Sequence:CCGGCGTTGTTGTCTTACAGTCTTACTCGAGTAAGACTGTAAGACAACAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138662.1-876s1c1
Sequence:CCGGAGACCCAATCAGTGGATACATCTCGAGATGTATCCACTGATTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138662.1-1029s1c1
Sequence:CCGGCGTGCCTGAATTGGTCATCAACTCGAGTTGATGACCAATTCAGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)