EMAIL THIS PAGE TO A FRIEND

PCDHA4

protocadherin alpha 4

332 Gene Product Result for
Synonyms: CNR1 CNRN1 CRNR1 PCDH-ALPHA4
UniProtKB ID: Q9UN74, O75285, Q2M253
Gene ID:
Human(56144) Summary: This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Mouse(12936) protocadherin alpha 4
Rat(116741) protocadherin alpha 4
chicken(497214) protocadherin alpha 4
dog(607212) protocadherin alpha 4
dog(607199) protocadherin alpha 4
domestic cat(101092733) protocadherin alpha 4
domestic guinea pig(100713594) protocadherin alpha 4
cow(616099) protocadherin alpha 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018907 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007766 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007766 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007766 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU229231 MISSION® esiRNA esiRNA targeting human PCDHA4 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018907 Rosetta Predictions human pricing
NM_031500 Rosetta Predictions human pricing
NM_053933 Rosetta Predictions rat pricing
NM_007766 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240656 predicted 1211
2 SASI_Hs01_00240657 predicted 1041
3 SASI_Hs01_00240658 predicted 1046
4 SASI_Hs01_00240659 predicted 677
5 SASI_Hs01_00240660 predicted 1077
6 SASI_Hs01_00240661 predicted 702
7 SASI_Hs01_00240662 predicted 678
8 SASI_Hs01_00240663 predicted 871
9 SASI_Hs01_00240664 predicted 976
10 SASI_Hs01_00240665 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076482 predicted 1209
2 SASI_Hs01_00076483 predicted 1036
3 SASI_Hs01_00076484 predicted 1044
4 SASI_Hs01_00076485 predicted 673
5 SASI_Hs01_00076486 predicted 1081
6 SASI_Hs01_00076487 predicted 702
7 SASI_Hs01_00076488 predicted 672
8 SASI_Hs01_00076489 predicted 875
9 SASI_Hs01_00076490 predicted 975
10 SASI_Hs01_00076491 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053933 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037439 predicted 504
2 SASI_Rn01_00037440 predicted 1800
3 SASI_Rn01_00037442 predicted 1872
4 SASI_Rn01_00037443 predicted 874
5 SASI_Rn01_00037444 predicted 699
6 SASI_Rn01_00037445 predicted 420
7 SASI_Rn01_00037446 predicted 1837
8 SASI_Rn02_00266886 predicted 899
9 SASI_Rn02_00266887 predicted 938
10 SASI_Rn02_00266888 predicted 2050
11 SASI_Rn01_00037438 predicted 3174
12 SASI_Rn01_00037441 predicted 2704
13 SASI_Rn01_00037447 predicted 85
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007766 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173096 predicted 3359
2 SASI_Mm01_00173097 predicted 3267
3 SASI_Mm01_00173098 predicted 1874
4 SASI_Mm01_00173099 predicted 574
5 SASI_Mm02_00312393 predicted 492
6 SASI_Mm01_00173100 predicted 499
7 SASI_Mm02_00312394 predicted 1432
8 SASI_Mm01_00173102 predicted 1945
9 SASI_Mm01_00173103 predicted 1955
10 SASI_Mm02_00312395 predicted 2366
11 SASI_Mm01_00173101 predicted 2780
12 SASI_Mm01_00173104 predicted 1454
13 SASI_Mm01_00173105 predicted 1026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018907
VALIDATED
PCDHA4 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018907.2-988s21c1
Sequence:CCGGATCCAATTACTGGACAAATTACTCGAGTAATTTGTCCAGTAATTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018907.2-868s21c1
Sequence:CCGGCTAATGGAACATTGGTAATTACTCGAGTAATTACCAATGTTCCATTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018907.2-2188s21c1
Sequence:CCGGTCAACGTATACCTGATCATTGCTCGAGCAATGATCAGGTATACGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018907.2-676s21c1
Sequence:CCGGTTGGGCTTATATTACGGAAATCTCGAGATTTCCGTAATATAAGCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018907.2-1119s21c1
Sequence:CCGGGTAGAAGACAACAACGATAATCTCGAGATTATCGTTGTTGTCTTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018907.2-138s1c1
Sequence:CCGGCGTCTGCTGCTCTTACTTCTTCTCGAGAAGAAGTAAGAGCAGCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018907.2-2459s1c1
Sequence:CCGGGCAGACAACTGAGGAATCCTTCTCGAGAAGGATTCCTCAGTTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018907.2-1226s1c1
Sequence:CCGGCGACAAAGACATGGGTGTCAACTCGAGTTGACACCCATGTCTTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018907.2-1050s1c1
Sequence:CCGGGAAATTATTGTAGAGGGCATTCTCGAGAATGCCCTCTACAATAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018907.2-706s21c1
Sequence:CCGGGAGAAGAAGCTCCGGAGATTTCTCGAGAAATCTCCGGAGCTTCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018907.2-960s1c1
Sequence:CCGGCCAAATGTGAAATCCAAGTTTCTCGAGAAACTTGGATTTCACATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018907
VALIDATED
PCDHA4 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018907.2-988s21c1
Sequence:CCGGATCCAATTACTGGACAAATTACTCGAGTAATTTGTCCAGTAATTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018907.2-868s21c1
Sequence:CCGGCTAATGGAACATTGGTAATTACTCGAGTAATTACCAATGTTCCATTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018907.2-2188s21c1
Sequence:CCGGTCAACGTATACCTGATCATTGCTCGAGCAATGATCAGGTATACGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018907.2-676s21c1
Sequence:CCGGTTGGGCTTATATTACGGAAATCTCGAGATTTCCGTAATATAAGCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018907.2-1119s21c1
Sequence:CCGGGTAGAAGACAACAACGATAATCTCGAGATTATCGTTGTTGTCTTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018907.2-138s1c1
Sequence:CCGGCGTCTGCTGCTCTTACTTCTTCTCGAGAAGAAGTAAGAGCAGCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018907.2-2459s1c1
Sequence:CCGGGCAGACAACTGAGGAATCCTTCTCGAGAAGGATTCCTCAGTTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018907.2-1226s1c1
Sequence:CCGGCGACAAAGACATGGGTGTCAACTCGAGTTGACACCCATGTCTTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018907.2-1050s1c1
Sequence:CCGGGAAATTATTGTAGAGGGCATTCTCGAGAATGCCCTCTACAATAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018907.2-706s21c1
Sequence:CCGGGAGAAGAAGCTCCGGAGATTTCTCGAGAAATCTCCGGAGCTTCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018907.2-960s1c1
Sequence:CCGGCCAAATGTGAAATCCAAGTTTCTCGAGAAACTTGGATTTCACATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018907
VALIDATED
PCDHA4 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018907.2-988s21c1
Sequence:CCGGATCCAATTACTGGACAAATTACTCGAGTAATTTGTCCAGTAATTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018907.2-868s21c1
Sequence:CCGGCTAATGGAACATTGGTAATTACTCGAGTAATTACCAATGTTCCATTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018907.2-2188s21c1
Sequence:CCGGTCAACGTATACCTGATCATTGCTCGAGCAATGATCAGGTATACGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018907.2-676s21c1
Sequence:CCGGTTGGGCTTATATTACGGAAATCTCGAGATTTCCGTAATATAAGCCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018907.2-1119s21c1
Sequence:CCGGGTAGAAGACAACAACGATAATCTCGAGATTATCGTTGTTGTCTTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018907.2-138s1c1
Sequence:CCGGCGTCTGCTGCTCTTACTTCTTCTCGAGAAGAAGTAAGAGCAGCAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018907.2-2459s1c1
Sequence:CCGGGCAGACAACTGAGGAATCCTTCTCGAGAAGGATTCCTCAGTTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018907.2-1226s1c1
Sequence:CCGGCGACAAAGACATGGGTGTCAACTCGAGTTGACACCCATGTCTTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018907.2-1050s1c1
Sequence:CCGGGAAATTATTGTAGAGGGCATTCTCGAGAATGCCCTCTACAATAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018907.2-706s21c1
Sequence:CCGGGAGAAGAAGCTCCGGAGATTTCTCGAGAAATCTCCGGAGCTTCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018907.2-960s1c1
Sequence:CCGGCCAAATGTGAAATCCAAGTTTCTCGAGAAACTTGGATTTCACATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007766
PCDHA4 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007766.1-1133s1c1
Sequence:CCGGCAAATCTCTATCACTTCCAATCTCGAGATTGGAAGTGATAGAGATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007766.1-3787s1c1
Sequence:CCGGCCTCACTTTATGCTGTTTGTTCTCGAGAACAAACAGCATAAAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007766.1-565s1c1
Sequence:CCGGGAATCAATGCTGTACTGACTTCTCGAGAAGTCAGTACAGCATTGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007766.1-746s1c1
Sequence:CCGGCGGCAGTGTTCAGTTACTCATCTCGAGATGAGTAACTGAACACTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007766.1-1964s1c1
Sequence:CCGGCGAGATTAGTACTACGCGCATCTCGAGATGCGCGTAGTACTAATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007766
PCDHA4 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007766.1-1133s1c1
Sequence:CCGGCAAATCTCTATCACTTCCAATCTCGAGATTGGAAGTGATAGAGATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007766.1-3787s1c1
Sequence:CCGGCCTCACTTTATGCTGTTTGTTCTCGAGAACAAACAGCATAAAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007766.1-565s1c1
Sequence:CCGGGAATCAATGCTGTACTGACTTCTCGAGAAGTCAGTACAGCATTGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007766.1-746s1c1
Sequence:CCGGCGGCAGTGTTCAGTTACTCATCTCGAGATGAGTAACTGAACACTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007766.1-1964s1c1
Sequence:CCGGCGAGATTAGTACTACGCGCATCTCGAGATGCGCGTAGTACTAATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007766
PCDHA4 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007766.1-1133s1c1
Sequence:CCGGCAAATCTCTATCACTTCCAATCTCGAGATTGGAAGTGATAGAGATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007766.1-3787s1c1
Sequence:CCGGCCTCACTTTATGCTGTTTGTTCTCGAGAACAAACAGCATAAAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007766.1-565s1c1
Sequence:CCGGGAATCAATGCTGTACTGACTTCTCGAGAAGTCAGTACAGCATTGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007766.1-746s1c1
Sequence:CCGGCGGCAGTGTTCAGTTACTCATCTCGAGATGAGTAACTGAACACTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007766.1-1964s1c1
Sequence:CCGGCGAGATTAGTACTACGCGCATCTCGAGATGCGCGTAGTACTAATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)