EMAIL THIS PAGE TO A FRIEND

PCDHA5

protocadherin alpha 5

246 Gene Product Result for
Synonyms: CNR6 CNRN6 CNRS6 CRNR6 PCDH-ALPHA5
UniProtKB ID: Q9Y5H7, O75284, Q8N4R3
Gene ID:
Human(56143) Summary: This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Mouse(12941) protocadherin alpha 5
Rat(393087) protocadherin alpha 5
cow(100847156) protocadherin alpha 5
domestic guinea pig(100713870) protocadherin alpha 5
naked mole-rat(101725566) protocadherin alpha 5
chicken(497215) protocadherin alpha 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009959 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009959 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009959 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018908 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018908 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018908 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103761 MISSION® esiRNA esiRNA human PCDHA5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018908 Rosetta Predictions human pricing
NM_031501 Rosetta Predictions human pricing
NM_199505 Rosetta Predictions rat pricing
NM_009959 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012251 predicted 505
2 SASI_Hs01_00012252 predicted 682
3 SASI_Hs01_00012253 predicted 494
4 SASI_Hs01_00012255 predicted 649
5 SASI_Hs01_00012256 predicted 611
6 SASI_Hs01_00012257 predicted 766
7 SASI_Hs01_00012258 predicted 608
8 SASI_Hs01_00012259 predicted 1004
9 SASI_Hs02_00352338 predicted 995
10 SASI_Hs02_00352339 predicted 484
11 SASI_Hs01_00012254 predicted 410
12 SASI_Hs01_00012260 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213363 predicted 499
2 SASI_Hs01_00213364 predicted 678
3 SASI_Hs01_00213365 predicted 502
4 SASI_Hs01_00213367 predicted 651
5 SASI_Hs01_00213368 predicted 616
6 SASI_Hs01_00213369 predicted 768
7 SASI_Hs01_00213370 predicted 605
8 SASI_Hs01_00213371 predicted 999
9 SASI_Hs02_00358941 predicted 987
10 SASI_Hs02_00358942 predicted 488
11 SASI_Hs01_00213366 predicted 402
12 SASI_Hs01_00213372 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051228 predicted 3307
2 SASI_Rn01_00051229 predicted 3124
3 SASI_Rn01_00051230 predicted 846
4 SASI_Rn02_00270279 predicted 802
5 SASI_Rn02_00270280 predicted 1009
6 SASI_Rn01_00051231 predicted 871
7 SASI_Rn01_00051232 predicted 2840
8 SASI_Rn01_00051233 predicted 2153
9 SASI_Rn01_00051234 predicted 731
10 SASI_Rn02_00270281 predicted 3080
11 SASI_Rn01_00051235 predicted 1114
12 SASI_Rn01_00051236 predicted 1192
13 SASI_Rn01_00051237 predicted 1554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126443 predicted 3248
2 SASI_Mm01_00126444 predicted 3149
3 SASI_Mm01_00126445 predicted 764
4 SASI_Mm01_00126446 predicted 2097
5 SASI_Mm02_00317522 predicted 21
6 SASI_Mm01_00126447 predicted 1878
7 SASI_Mm01_00126448 predicted 718
8 SASI_Mm01_00126449 predicted 2887
9 SASI_Mm01_00126451 predicted 2059
10 SASI_Mm02_00317523 predicted 670
11 SASI_Mm01_00126450 predicted 2666
12 SASI_Mm01_00126452 predicted 2076
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009959
PCDHA5 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009959.1-3822s1c1
Sequence:CCGGGCTGCTACAGAAGTGCTTTAACTCGAGTTAAAGCACTTCTGTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009959.1-1713s1c1
Sequence:CCGGCGGAGGAACTATTGAGTTGTTCTCGAGAACAACTCAATAGTTCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009959.1-401s1c1
Sequence:CCGGCACGACCTGAACAAAGATTATCTCGAGATAATCTTTGTTCAGGTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009959.1-403s1c1
Sequence:CCGGCGACCTGAACAAAGATTATTTCTCGAGAAATAATCTTTGTTCAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009959.1-718s1c1
Sequence:CCGGCCGGAGTTTGATAAATCTATTCTCGAGAATAGATTTATCAAACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009959
PCDHA5 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009959.1-3822s1c1
Sequence:CCGGGCTGCTACAGAAGTGCTTTAACTCGAGTTAAAGCACTTCTGTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009959.1-1713s1c1
Sequence:CCGGCGGAGGAACTATTGAGTTGTTCTCGAGAACAACTCAATAGTTCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009959.1-401s1c1
Sequence:CCGGCACGACCTGAACAAAGATTATCTCGAGATAATCTTTGTTCAGGTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009959.1-403s1c1
Sequence:CCGGCGACCTGAACAAAGATTATTTCTCGAGAAATAATCTTTGTTCAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009959.1-718s1c1
Sequence:CCGGCCGGAGTTTGATAAATCTATTCTCGAGAATAGATTTATCAAACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009959
PCDHA5 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009959.1-3822s1c1
Sequence:CCGGGCTGCTACAGAAGTGCTTTAACTCGAGTTAAAGCACTTCTGTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009959.1-1713s1c1
Sequence:CCGGCGGAGGAACTATTGAGTTGTTCTCGAGAACAACTCAATAGTTCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009959.1-401s1c1
Sequence:CCGGCACGACCTGAACAAAGATTATCTCGAGATAATCTTTGTTCAGGTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009959.1-403s1c1
Sequence:CCGGCGACCTGAACAAAGATTATTTCTCGAGAAATAATCTTTGTTCAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009959.1-718s1c1
Sequence:CCGGCCGGAGTTTGATAAATCTATTCTCGAGAATAGATTTATCAAACTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018908
VALIDATED
PCDHA5 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000365511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-919s21c1
Sequence:CCGGCTGGATTATGAAGACTATAACCTCGAGGTTATAGTCTTCATAATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-800s21c1
Sequence:CCGGATGCAGATGAGGGCATCAATACTCGAGTATTGATGCCCTCATCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018908.2-506s1c1
Sequence:CCGGACAGGTTAAATCCAAACGAATCTCGAGATTCGTTTGGATTTAACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_018908.2-398s1c1
Sequence:CCGGCCAGACAAGAACAAAGATTATCTCGAGATAATCTTTGTTCTTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018908.2-808s1c1
Sequence:CCGGGAGGGCATCAATAAGGAAATACTCGAGTATTTCCTTATTGATGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018908.2-994s1c1
Sequence:CCGGCACTGTAAAGTAGTAGTGAAACTCGAGTTTCACTACTACTTTACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018908.2-655s1c1
Sequence:CCGGCCCGAACTAACAGGTACAGTTCTCGAGAACTGTACCTGTTAGTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-426s21c1
Sequence:CCGGAGAGTCAAGAATGCCAGATTCCTCGAGGAATCTGGCATTCTTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-764s21c1
Sequence:CCGGCAAGTGGGACATTAGTTATTACTCGAGTAATAACTAATGTCCCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018908.2-496s21c1
Sequence:CCGGCAATTGAGATACAGGTTAAATCTCGAGATTTAACCTGTATCTCAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-855s21c1
Sequence:CCGGTGACGATGTAAAGTCCAAATTCTCGAGAATTTGGACTTTACATCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-610s21c1
Sequence:CCGGACACAAGAACACCGTTTATTACTCGAGTAATAAACGGTGTTCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018908
VALIDATED
PCDHA5 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000365511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-919s21c1
Sequence:CCGGCTGGATTATGAAGACTATAACCTCGAGGTTATAGTCTTCATAATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-800s21c1
Sequence:CCGGATGCAGATGAGGGCATCAATACTCGAGTATTGATGCCCTCATCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018908.2-506s1c1
Sequence:CCGGACAGGTTAAATCCAAACGAATCTCGAGATTCGTTTGGATTTAACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_018908.2-398s1c1
Sequence:CCGGCCAGACAAGAACAAAGATTATCTCGAGATAATCTTTGTTCTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018908.2-808s1c1
Sequence:CCGGGAGGGCATCAATAAGGAAATACTCGAGTATTTCCTTATTGATGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018908.2-994s1c1
Sequence:CCGGCACTGTAAAGTAGTAGTGAAACTCGAGTTTCACTACTACTTTACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018908.2-655s1c1
Sequence:CCGGCCCGAACTAACAGGTACAGTTCTCGAGAACTGTACCTGTTAGTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-426s21c1
Sequence:CCGGAGAGTCAAGAATGCCAGATTCCTCGAGGAATCTGGCATTCTTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-764s21c1
Sequence:CCGGCAAGTGGGACATTAGTTATTACTCGAGTAATAACTAATGTCCCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018908.2-496s21c1
Sequence:CCGGCAATTGAGATACAGGTTAAATCTCGAGATTTAACCTGTATCTCAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-855s21c1
Sequence:CCGGTGACGATGTAAAGTCCAAATTCTCGAGAATTTGGACTTTACATCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-610s21c1
Sequence:CCGGACACAAGAACACCGTTTATTACTCGAGTAATAAACGGTGTTCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018908
VALIDATED
PCDHA5 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000365511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-919s21c1
Sequence:CCGGCTGGATTATGAAGACTATAACCTCGAGGTTATAGTCTTCATAATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-800s21c1
Sequence:CCGGATGCAGATGAGGGCATCAATACTCGAGTATTGATGCCCTCATCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018908.2-506s1c1
Sequence:CCGGACAGGTTAAATCCAAACGAATCTCGAGATTCGTTTGGATTTAACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_018908.2-398s1c1
Sequence:CCGGCCAGACAAGAACAAAGATTATCTCGAGATAATCTTTGTTCTTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018908.2-808s1c1
Sequence:CCGGGAGGGCATCAATAAGGAAATACTCGAGTATTTCCTTATTGATGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018908.2-994s1c1
Sequence:CCGGCACTGTAAAGTAGTAGTGAAACTCGAGTTTCACTACTACTTTACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018908.2-655s1c1
Sequence:CCGGCCCGAACTAACAGGTACAGTTCTCGAGAACTGTACCTGTTAGTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-426s21c1
Sequence:CCGGAGAGTCAAGAATGCCAGATTCCTCGAGGAATCTGGCATTCTTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-764s21c1
Sequence:CCGGCAAGTGGGACATTAGTTATTACTCGAGTAATAACTAATGTCCCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018908.2-496s21c1
Sequence:CCGGCAATTGAGATACAGGTTAAATCTCGAGATTTAACCTGTATCTCAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-855s21c1
Sequence:CCGGTGACGATGTAAAGTCCAAATTCTCGAGAATTTGGACTTTACATCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018908.2-610s21c1
Sequence:CCGGACACAAGAACACCGTTTATTACTCGAGTAATAAACGGTGTTCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)