EMAIL THIS PAGE TO A FRIEND

PCDHA6

protocadherin alpha 6

256 Gene Product Result for
Synonyms: CNR2 CNRN2 CNRS2 CRNR2 PCDH-ALPHA6
UniProtKB ID: Q9UN73, O75283, Q9NRT8
Gene ID:
Human(56142) Summary: This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Mouse(12937) protocadherin alpha 6
Rat(393088) protocadherin alpha 6
chicken(497216) protocadherin alpha 6
domestic cat(101099699) protocadherin alpha 6
dog(607224) protocadherin alpha 6
cow(616024) protocadherin alpha 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018909 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018909 Rosetta Predictions human pricing
NM_031848 Rosetta Predictions human pricing
NM_031849 Rosetta Predictions human pricing
NM_199506 Rosetta Predictions rat pricing
NM_007767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070133 predicted 794
2 SASI_Hs01_00070134 predicted 818
3 SASI_Hs01_00070135 predicted 761
4 SASI_Hs01_00070136 predicted 897
5 SASI_Hs01_00070139 predicted 981
6 SASI_Hs01_00070140 predicted 745
7 SASI_Hs02_00352340 predicted 1070
8 SASI_Hs02_00352341 predicted 882
9 SASI_Hs02_00352342 predicted 551
10 SASI_Hs02_00352343 predicted 1117
11 SASI_Hs01_00070137 predicted 878
12 SASI_Hs01_00070138 predicted 465
13 SASI_Hs01_00070141 predicted 787
14 SASI_Hs01_00070142 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242980 predicted 791
2 SASI_Hs01_00242981 predicted 818
3 SASI_Hs01_00242982 predicted 767
4 SASI_Hs01_00242983 predicted 895
5 SASI_Hs01_00242986 predicted 974
6 SASI_Hs01_00242987 predicted 741
7 SASI_Hs02_00358947 predicted 884
8 SASI_Hs02_00358948 predicted 546
9 SASI_Hs02_00358949 predicted 1115
10 SASI_Hs02_00358950 predicted 544
11 SASI_Hs01_00242984 predicted 880
12 SASI_Hs01_00242985 predicted 468
13 SASI_Hs01_00242988 predicted 453
14 SASI_Hs01_00242989 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121527 predicted 2224
2 SASI_Hs01_00121528 predicted 2456
3 SASI_Hs01_00121529 predicted 1876
4 SASI_Hs01_00121530 predicted 1936
5 SASI_Hs01_00121531 predicted 793
6 SASI_Hs01_00121533 predicted 762
7 SASI_Hs01_00121534 predicted 2187
8 SASI_Hs01_00121536 predicted 411
9 SASI_Hs02_00358951 predicted 2182
10 SASI_Hs02_00358952 predicted 1854
11 SASI_Hs01_00121532 predicted 49
12 SASI_Hs01_00121535 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090344 predicted 3209
2 SASI_Rn01_00090345 predicted 3030
3 SASI_Rn02_00270282 predicted 1846
4 SASI_Rn01_00090346 predicted 564
5 SASI_Rn01_00090347 predicted 2738
6 SASI_Rn02_00270283 predicted 1868
7 SASI_Rn01_00090349 predicted 2133
8 SASI_Rn01_00090350 predicted 944
9 SASI_Rn01_00090351 predicted 476
10 SASI_Rn01_00090352 predicted 2175
11 SASI_Rn01_00090348 predicted 1924
12 SASI_Rn01_00090353 predicted 1825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044469 predicted 3288
2 SASI_Mm01_00044470 predicted 3187
3 SASI_Mm01_00044471 predicted 1032
4 SASI_Mm01_00044472 predicted 520
5 SASI_Mm01_00044473 predicted 784
6 SASI_Mm02_00312396 predicted 2925
7 SASI_Mm01_00044476 predicted 2350
8 SASI_Mm02_00312397 predicted 1037
9 SASI_Mm01_00044477 predicted 914
10 SASI_Mm01_00044478 predicted 776
11 SASI_Mm01_00044474 predicted 1501
12 SASI_Mm01_00044475 predicted 2828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018909
PCDHA6 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018909.2-877s21c1
Sequence:CCGGCTTGTTGCAGCCATGGTTATTCTCGAGAATAACCATGGCTGCAACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018909.2-537s21c1
Sequence:CCGGTAAACTCAGTTCTAGCGAATACTCGAGTATTCGCTAGAACTGAGTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018909.2-2352s1c1
Sequence:CCGGCCTTTCACCTTGTCCTATTATCTCGAGATAATAGGACAAGGTGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018909.2-443s1c1
Sequence:CCGGGAGTGCTGATTTACGAATCTACTCGAGTAGATTCGTAAATCAGCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018909.2-1363s1c1
Sequence:CCGGGCCGACATGAATGACAATGCTCTCGAGAGCATTGTCATTCATGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018909.2-591s1c1
Sequence:CCGGCAATAAACAAATTGGGCTCTTCTCGAGAAGAGCCCAATTTGTTTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018909.2-2381s21c1
Sequence:CCGGAGGCGGAGAATCAGGATTTAACTCGAGTTAAATCCTGATTCTCCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018909.2-912s1c1
Sequence:CCGGAGATCGAAATACGGGAGAAATCTCGAGATTTCTCCCGTATTTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018909
PCDHA6 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018909.2-877s21c1
Sequence:CCGGCTTGTTGCAGCCATGGTTATTCTCGAGAATAACCATGGCTGCAACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018909.2-537s21c1
Sequence:CCGGTAAACTCAGTTCTAGCGAATACTCGAGTATTCGCTAGAACTGAGTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018909.2-2352s1c1
Sequence:CCGGCCTTTCACCTTGTCCTATTATCTCGAGATAATAGGACAAGGTGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018909.2-443s1c1
Sequence:CCGGGAGTGCTGATTTACGAATCTACTCGAGTAGATTCGTAAATCAGCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018909.2-1363s1c1
Sequence:CCGGGCCGACATGAATGACAATGCTCTCGAGAGCATTGTCATTCATGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018909.2-591s1c1
Sequence:CCGGCAATAAACAAATTGGGCTCTTCTCGAGAAGAGCCCAATTTGTTTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018909.2-2381s21c1
Sequence:CCGGAGGCGGAGAATCAGGATTTAACTCGAGTTAAATCCTGATTCTCCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018909.2-912s1c1
Sequence:CCGGAGATCGAAATACGGGAGAAATCTCGAGATTTCTCCCGTATTTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018909
PCDHA6 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018909.2-877s21c1
Sequence:CCGGCTTGTTGCAGCCATGGTTATTCTCGAGAATAACCATGGCTGCAACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018909.2-537s21c1
Sequence:CCGGTAAACTCAGTTCTAGCGAATACTCGAGTATTCGCTAGAACTGAGTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018909.2-2352s1c1
Sequence:CCGGCCTTTCACCTTGTCCTATTATCTCGAGATAATAGGACAAGGTGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018909.2-443s1c1
Sequence:CCGGGAGTGCTGATTTACGAATCTACTCGAGTAGATTCGTAAATCAGCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018909.2-1363s1c1
Sequence:CCGGGCCGACATGAATGACAATGCTCTCGAGAGCATTGTCATTCATGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018909.2-591s1c1
Sequence:CCGGCAATAAACAAATTGGGCTCTTCTCGAGAAGAGCCCAATTTGTTTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018909.2-2381s21c1
Sequence:CCGGAGGCGGAGAATCAGGATTTAACTCGAGTTAAATCCTGATTCTCCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018909.2-912s1c1
Sequence:CCGGAGATCGAAATACGGGAGAAATCTCGAGATTTCTCCCGTATTTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007767
PCDHA6 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007767.1-4288s1c1
Sequence:CCGGCGCCTTGTTTAGCTTTCCTTTCTCGAGAAAGGAAAGCTAAACAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007767.1-858s1c1
Sequence:CCGGCCCTGAGTATGAAGTGAGAATCTCGAGATTCTCACTTCATACTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007767.1-2757s1c1
Sequence:CCGGCGGTGAGTTGCCAGACAAATTCTCGAGAATTTGTCTGGCAACTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007767.1-683s1c1
Sequence:CCGGGCGATGGCAACAAACAAATTACTCGAGTAATTTGTTTGTTGCCATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007767.1-2824s1c1
Sequence:CCGGGCTAACAACCAAATTGACAAACTCGAGTTTGTCAATTTGGTTGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007767
PCDHA6 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007767.1-4288s1c1
Sequence:CCGGCGCCTTGTTTAGCTTTCCTTTCTCGAGAAAGGAAAGCTAAACAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007767.1-858s1c1
Sequence:CCGGCCCTGAGTATGAAGTGAGAATCTCGAGATTCTCACTTCATACTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007767.1-2757s1c1
Sequence:CCGGCGGTGAGTTGCCAGACAAATTCTCGAGAATTTGTCTGGCAACTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007767.1-683s1c1
Sequence:CCGGGCGATGGCAACAAACAAATTACTCGAGTAATTTGTTTGTTGCCATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007767.1-2824s1c1
Sequence:CCGGGCTAACAACCAAATTGACAAACTCGAGTTTGTCAATTTGGTTGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007767
PCDHA6 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007767.1-4288s1c1
Sequence:CCGGCGCCTTGTTTAGCTTTCCTTTCTCGAGAAAGGAAAGCTAAACAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007767.1-858s1c1
Sequence:CCGGCCCTGAGTATGAAGTGAGAATCTCGAGATTCTCACTTCATACTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007767.1-2757s1c1
Sequence:CCGGCGGTGAGTTGCCAGACAAATTCTCGAGAATTTGTCTGGCAACTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007767.1-683s1c1
Sequence:CCGGGCGATGGCAACAAACAAATTACTCGAGTAATTTGTTTGTTGCCATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007767.1-2824s1c1
Sequence:CCGGGCTAACAACCAAATTGACAAACTCGAGTTTGTCAATTTGGTTGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)