EMAIL THIS PAGE TO A FRIEND

PCDHA7

protocadherin alpha 7

247 Gene Product Result for
Synonyms: CNR4 CNRN4 CNRS4 CRNR4 PCDH-ALPHA7
UniProtKB ID: Q9UN72, O75282
Gene ID:
Human(56141) Summary: This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Mouse(12939) protocadherin alpha 7
Rat(393089) protocadherin alpha 7
domestic guinea pig(100714152) protocadherin alpha 7
naked mole-rat(101729229) protocadherin alpha 7
chicken(497217) protocadherin alpha 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009957 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009957 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009957 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018910 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129101 MISSION® esiRNA esiRNA human PCDHA7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018910 Rosetta Predictions human pricing
NM_031852 Rosetta Predictions human pricing
NM_199507 Rosetta Predictions rat pricing
NM_009957 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063979 predicted 617
2 SASI_Hs02_00352344 predicted 656
3 SASI_Hs01_00063980 predicted 661
4 SASI_Hs02_00352345 predicted 658
5 SASI_Hs01_00063981 predicted 751
6 SASI_Hs02_00352346 predicted 657
7 SASI_Hs01_00063983 predicted 642
8 SASI_Hs01_00063985 predicted 716
9 SASI_Hs02_00352347 predicted 710
10 SASI_Hs01_00063987 predicted 724
11 SASI_Hs01_00063978 predicted 662
12 SASI_Hs01_00063982 predicted 686
13 SASI_Hs01_00063984 predicted 663
14 SASI_Hs01_00063986 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074324 predicted 618
2 SASI_Hs02_00358955 predicted 653
3 SASI_Hs01_00074325 predicted 665
4 SASI_Hs02_00358956 predicted 658
5 SASI_Hs01_00074326 predicted 756
6 SASI_Hs02_00358957 predicted 656
7 SASI_Hs01_00074328 predicted 634
8 SASI_Hs01_00074330 predicted 714
9 SASI_Hs02_00358958 predicted 717
10 SASI_Hs01_00074332 predicted 721
11 SASI_Hs01_00074323 predicted 660
12 SASI_Hs01_00074327 predicted 685
13 SASI_Hs01_00074329 predicted 670
14 SASI_Hs01_00074331 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199507 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107399 predicted 3134
2 SASI_Rn01_00107400 predicted 989
3 SASI_Rn02_00270284 predicted 768
4 SASI_Rn01_00107401 predicted 2663
5 SASI_Rn01_00107402 predicted 1107
6 SASI_Rn02_00270285 predicted 1932
7 SASI_Rn01_00107404 predicted 902
8 SASI_Rn01_00107405 predicted 624
9 SASI_Rn01_00107406 predicted 1716
10 SASI_Rn01_00107407 predicted 797
11 SASI_Rn01_00107403 predicted 1120
12 SASI_Rn01_00107408 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009957 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023859 predicted 3254
2 SASI_Mm01_00023860 predicted 3162
3 SASI_Mm02_00317519 predicted 383
4 SASI_Mm01_00023861 predicted 900
5 SASI_Mm02_00317520 predicted 935
6 SASI_Mm01_00023862 predicted 1799
7 SASI_Mm01_00023863 predicted 997
8 SASI_Mm02_00317521 predicted 414
9 SASI_Mm01_00023865 predicted 902
10 SASI_Mm01_00023866 predicted 842
11 SASI_Mm01_00023864 predicted 2673
12 SASI_Mm01_00023867 predicted 803
13 SASI_Mm01_00023868 predicted 1044
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009957
PCDHA7 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009957.1-2888s1c1
Sequence:CCGGCGCTCCTTTCTCCTATGACATCTCGAGATGTCATAGGAGAAAGGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009957.1-1724s1c1
Sequence:CCGGGCACAATGAATGAGGTAGTATCTCGAGATACTACCTCATTCATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009957.1-30s1c1
Sequence:CCGGGAGCCAACAATTACTCCTGTTCTCGAGAACAGGAGTAATTGTTGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009957.1-2667s1c1
Sequence:CCGGGCCTGCTAACAACCAAATTGACTCGAGTCAATTTGGTTGTTAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009957.1-1104s1c1
Sequence:CCGGCGTCACTTTAATTAGCGTATTCTCGAGAATACGCTAATTAAAGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009957
PCDHA7 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009957.1-2888s1c1
Sequence:CCGGCGCTCCTTTCTCCTATGACATCTCGAGATGTCATAGGAGAAAGGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009957.1-1724s1c1
Sequence:CCGGGCACAATGAATGAGGTAGTATCTCGAGATACTACCTCATTCATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009957.1-30s1c1
Sequence:CCGGGAGCCAACAATTACTCCTGTTCTCGAGAACAGGAGTAATTGTTGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009957.1-2667s1c1
Sequence:CCGGGCCTGCTAACAACCAAATTGACTCGAGTCAATTTGGTTGTTAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009957.1-1104s1c1
Sequence:CCGGCGTCACTTTAATTAGCGTATTCTCGAGAATACGCTAATTAAAGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009957
PCDHA7 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009957.1-2888s1c1
Sequence:CCGGCGCTCCTTTCTCCTATGACATCTCGAGATGTCATAGGAGAAAGGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009957.1-1724s1c1
Sequence:CCGGGCACAATGAATGAGGTAGTATCTCGAGATACTACCTCATTCATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009957.1-30s1c1
Sequence:CCGGGAGCCAACAATTACTCCTGTTCTCGAGAACAGGAGTAATTGTTGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009957.1-2667s1c1
Sequence:CCGGGCCTGCTAACAACCAAATTGACTCGAGTCAATTTGGTTGTTAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009957.1-1104s1c1
Sequence:CCGGCGTCACTTTAATTAGCGTATTCTCGAGAATACGCTAATTAAAGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018910
PCDHA7 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018910.2-113s21c1
Sequence:CCGGAGGCTAAACATGGCAACTTCGCTCGAGCGAAGTTGCCATGTTTAGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018910.2-32s1c1
Sequence:CCGGGCCGACATCTACTGCTGTTTACTCGAGTAAACAGCAGTAGATGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018910.2-2338s1c1
Sequence:CCGGCCATCCTCTACAGACAATCCACTCGAGTGGATTGTCTGTAGAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018910.2-1104s1c1
Sequence:CCGGCATCACATTGATTAGCGTGTTCTCGAGAACACGCTAATCAATGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018910.2-2186s1c1
Sequence:CCGGAGGGCGCATGTAGTTTGGTAACTCGAGTTACCAAACTACATGCGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018910.2-1065s21c1
Sequence:CCGGGTCTCTCCCTATTCCAGAGGACTCGAGTCCTCTGGAATAGGGAGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018910.2-1040s1c1
Sequence:CCGGCTCCACAGTTGACTCTCACTTCTCGAGAAGTGAGAGTCAACTGTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018910.2-216s21c1
Sequence:CCGGGGATCTTCTGGAGGTAAATCTCTCGAGAGATTTACCTCCAGAAGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018910.2-1003s21c1
Sequence:CCGGACAGTTCTTGTGGAAGTTGTGCTCGAGCACAACTTCCACAAGAACTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018910
PCDHA7 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018910.2-113s21c1
Sequence:CCGGAGGCTAAACATGGCAACTTCGCTCGAGCGAAGTTGCCATGTTTAGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018910.2-32s1c1
Sequence:CCGGGCCGACATCTACTGCTGTTTACTCGAGTAAACAGCAGTAGATGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018910.2-2338s1c1
Sequence:CCGGCCATCCTCTACAGACAATCCACTCGAGTGGATTGTCTGTAGAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018910.2-1104s1c1
Sequence:CCGGCATCACATTGATTAGCGTGTTCTCGAGAACACGCTAATCAATGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018910.2-2186s1c1
Sequence:CCGGAGGGCGCATGTAGTTTGGTAACTCGAGTTACCAAACTACATGCGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018910.2-1065s21c1
Sequence:CCGGGTCTCTCCCTATTCCAGAGGACTCGAGTCCTCTGGAATAGGGAGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018910.2-1040s1c1
Sequence:CCGGCTCCACAGTTGACTCTCACTTCTCGAGAAGTGAGAGTCAACTGTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018910.2-216s21c1
Sequence:CCGGGGATCTTCTGGAGGTAAATCTCTCGAGAGATTTACCTCCAGAAGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018910.2-1003s21c1
Sequence:CCGGACAGTTCTTGTGGAAGTTGTGCTCGAGCACAACTTCCACAAGAACTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018910
PCDHA7 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018910.2-113s21c1
Sequence:CCGGAGGCTAAACATGGCAACTTCGCTCGAGCGAAGTTGCCATGTTTAGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018910.2-32s1c1
Sequence:CCGGGCCGACATCTACTGCTGTTTACTCGAGTAAACAGCAGTAGATGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018910.2-2338s1c1
Sequence:CCGGCCATCCTCTACAGACAATCCACTCGAGTGGATTGTCTGTAGAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018910.2-1104s1c1
Sequence:CCGGCATCACATTGATTAGCGTGTTCTCGAGAACACGCTAATCAATGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018910.2-2186s1c1
Sequence:CCGGAGGGCGCATGTAGTTTGGTAACTCGAGTTACCAAACTACATGCGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018910.2-1065s21c1
Sequence:CCGGGTCTCTCCCTATTCCAGAGGACTCGAGTCCTCTGGAATAGGGAGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018910.2-1040s1c1
Sequence:CCGGCTCCACAGTTGACTCTCACTTCTCGAGAAGTGAGAGTCAACTGTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018910.2-216s21c1
Sequence:CCGGGGATCTTCTGGAGGTAAATCTCTCGAGAGATTTACCTCCAGAAGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018910.2-1003s21c1
Sequence:CCGGACAGTTCTTGTGGAAGTTGTGCTCGAGCACAACTTCCACAAGAACTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)