EMAIL THIS PAGE TO A FRIEND

PCDHA8

protocadherin alpha 8

234 Gene Product Result for
Synonyms: PCDH-ALPHA8
UniProtKB ID: Q9Y5H6, B9EGT7, O75281
Gene ID:
Human(56140) Summary: This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Mouse(353235) protocadherin alpha 8
Rat(116781) protocadherin alpha 8
chicken(497218) protocadherin alpha 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018911 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201243 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201243 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201243 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148241 MISSION® esiRNA esiRNA human PCDHA8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018911 Rosetta Predictions human pricing
NM_031856 Rosetta Predictions human pricing
NM_053942 Rosetta Predictions rat pricing
NM_201243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235727 predicted 768
2 SASI_Hs01_00235728 predicted 786
3 SASI_Hs01_00235729 predicted 871
4 SASI_Hs01_00235730 predicted 494
5 SASI_Hs02_00352348 predicted 953
6 SASI_Hs01_00235731 predicted 856
7 SASI_Hs01_00235732 predicted 620
8 SASI_Hs01_00235733 predicted 716
9 SASI_Hs01_00235734 predicted 1041
10 SASI_Hs01_00235735 predicted 486
11 SASI_Hs01_00235736 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358962 predicted 765
2 SASI_Hs01_00174016 predicted 788
3 SASI_Hs01_00174017 predicted 869
4 SASI_Hs01_00174018 predicted 493
5 SASI_Hs02_00358963 predicted 948
6 SASI_Hs01_00174019 predicted 858
7 SASI_Hs01_00174020 predicted 621
8 SASI_Hs01_00174021 predicted 712
9 SASI_Hs02_00358964 predicted 1037
10 SASI_Hs01_00174022 predicted 481
11 SASI_Hs01_00174023 predicted 737
12 SASI_Hs01_00174024 predicted 537
13 SASI_Hs01_00174025 predicted 36
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035491 predicted 3170
2 SASI_Rn01_00035492 predicted 487
3 SASI_Rn01_00035494 predicted 415
4 SASI_Rn01_00035495 predicted 2698
5 SASI_Rn01_00035497 predicted 550
6 SASI_Rn01_00035498 predicted 892
7 SASI_Rn01_00035499 predicted 1671
8 SASI_Rn01_00035500 predicted 1429
9 SASI_Rn02_00266899 predicted 1949
10 SASI_Rn02_00266900 predicted 2076
11 SASI_Rn01_00035493 predicted 2283
12 SASI_Rn01_00035496 predicted 1371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175515 predicted 3281
2 SASI_Mm01_00175516 predicted 3187
3 SASI_Mm02_00351495 predicted 390
4 SASI_Mm01_00175517 predicted 1708
5 SASI_Mm01_00175518 predicted 1247
6 SASI_Mm01_00175519 predicted 1860
7 SASI_Mm01_00175520 predicted 1031
8 SASI_Mm02_00351496 predicted 927
9 SASI_Mm01_00175522 predicted 33
10 SASI_Mm01_00175523 predicted 761
11 SASI_Mm01_00175521 predicted 901
12 SASI_Mm01_00175524 predicted 2694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018911
PCDHA8 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018911.2-437s21c1
Sequence:CCGGGAATGCCAGACTCTCGGTTTCCTCGAGGAAACCGAGAGTCTGGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018911.2-523s1c1
Sequence:CCGGCATGATTACTTCATGCTAGATCTCGAGATCTAGCATGAAGTAATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018911.2-3897s1c1
Sequence:CCGGGCCTGAAACATCTGTATTATACTCGAGTATAATACAGATGTTTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018911.2-2353s1c1
Sequence:CCGGGTAGGCGAAGAGCAAGATTTACTCGAGTAAATCTTGCTCTTCGCCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018911.2-361s1c1
Sequence:CCGGGTGGAGGTGAAGGATGTTAATCTCGAGATTAACATCCTTCACCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018911.2-230s21c1
Sequence:CCGGTAAGTCTGCAGAATGGCATTTCTCGAGAAATGCCATTCTGCAGACTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018911.2-570s21c1
Sequence:CCGGACTGGTTGAGCTCGTATTAAGCTCGAGCTTAATACGAGCTCAACCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018911.2-848s1c1
Sequence:CCGGGCCTTGTTGAAACTATGGTTACTCGAGTAACCATAGTTTCAACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018911
PCDHA8 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018911.2-437s21c1
Sequence:CCGGGAATGCCAGACTCTCGGTTTCCTCGAGGAAACCGAGAGTCTGGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018911.2-523s1c1
Sequence:CCGGCATGATTACTTCATGCTAGATCTCGAGATCTAGCATGAAGTAATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018911.2-3897s1c1
Sequence:CCGGGCCTGAAACATCTGTATTATACTCGAGTATAATACAGATGTTTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018911.2-2353s1c1
Sequence:CCGGGTAGGCGAAGAGCAAGATTTACTCGAGTAAATCTTGCTCTTCGCCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018911.2-361s1c1
Sequence:CCGGGTGGAGGTGAAGGATGTTAATCTCGAGATTAACATCCTTCACCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018911.2-230s21c1
Sequence:CCGGTAAGTCTGCAGAATGGCATTTCTCGAGAAATGCCATTCTGCAGACTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018911.2-570s21c1
Sequence:CCGGACTGGTTGAGCTCGTATTAAGCTCGAGCTTAATACGAGCTCAACCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018911.2-848s1c1
Sequence:CCGGGCCTTGTTGAAACTATGGTTACTCGAGTAACCATAGTTTCAACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018911
PCDHA8 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018911.2-437s21c1
Sequence:CCGGGAATGCCAGACTCTCGGTTTCCTCGAGGAAACCGAGAGTCTGGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018911.2-523s1c1
Sequence:CCGGCATGATTACTTCATGCTAGATCTCGAGATCTAGCATGAAGTAATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018911.2-3897s1c1
Sequence:CCGGGCCTGAAACATCTGTATTATACTCGAGTATAATACAGATGTTTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018911.2-2353s1c1
Sequence:CCGGGTAGGCGAAGAGCAAGATTTACTCGAGTAAATCTTGCTCTTCGCCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018911.2-361s1c1
Sequence:CCGGGTGGAGGTGAAGGATGTTAATCTCGAGATTAACATCCTTCACCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018911.2-230s21c1
Sequence:CCGGTAAGTCTGCAGAATGGCATTTCTCGAGAAATGCCATTCTGCAGACTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018911.2-570s21c1
Sequence:CCGGACTGGTTGAGCTCGTATTAAGCTCGAGCTTAATACGAGCTCAACCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018911.2-848s1c1
Sequence:CCGGGCCTTGTTGAAACTATGGTTACTCGAGTAACCATAGTTTCAACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201243
PCDHA8 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201243.1-2847s1c1
Sequence:CCGGCCAAATGGAAACAAGCCACTTCTCGAGAAGTGGCTTGTTTCCATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201243.1-1859s1c1
Sequence:CCGGGCCCATTTCGTGTAGGATTATCTCGAGATAATCCTACACGAAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201243.1-2645s1c1
Sequence:CCGGACAAATTCATTATCCCAGGATCTCGAGATCCTGGGATAATGAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201243.1-1108s1c1
Sequence:CCGGGCCCTGATCAGTGTGATTGATCTCGAGATCAATCACACTGATCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201243.1-34s1c1
Sequence:CCGGCAGCTTCTAGTGCTTTCGCTTCTCGAGAAGCGAAAGCACTAGAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201243
PCDHA8 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201243.1-2847s1c1
Sequence:CCGGCCAAATGGAAACAAGCCACTTCTCGAGAAGTGGCTTGTTTCCATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201243.1-1859s1c1
Sequence:CCGGGCCCATTTCGTGTAGGATTATCTCGAGATAATCCTACACGAAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201243.1-2645s1c1
Sequence:CCGGACAAATTCATTATCCCAGGATCTCGAGATCCTGGGATAATGAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201243.1-1108s1c1
Sequence:CCGGGCCCTGATCAGTGTGATTGATCTCGAGATCAATCACACTGATCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201243.1-34s1c1
Sequence:CCGGCAGCTTCTAGTGCTTTCGCTTCTCGAGAAGCGAAAGCACTAGAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201243
PCDHA8 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201243.1-2847s1c1
Sequence:CCGGCCAAATGGAAACAAGCCACTTCTCGAGAAGTGGCTTGTTTCCATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201243.1-1859s1c1
Sequence:CCGGGCCCATTTCGTGTAGGATTATCTCGAGATAATCCTACACGAAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201243.1-2645s1c1
Sequence:CCGGACAAATTCATTATCCCAGGATCTCGAGATCCTGGGATAATGAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201243.1-1108s1c1
Sequence:CCGGGCCCTGATCAGTGTGATTGATCTCGAGATCAATCACACTGATCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201243.1-34s1c1
Sequence:CCGGCAGCTTCTAGTGCTTTCGCTTCTCGAGAAGCGAAAGCACTAGAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)