EMAIL THIS PAGE TO A FRIEND

PCDHA9

protocadherin alpha 9

237 Gene Product Result for
Synonyms: PCDH-ALPHA9
UniProtKB ID: Q9Y5H5, O15053, Q2M3S5
Gene ID:
Human(9752) Summary: This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Mouse(192161) protocadherin alpha 9
Rat(393090) protocadherin alpha 9
cow(616121) protocadherin alpha 9
cow(539540) protocadherin alpha 9
domestic guinea pig(100714706) protocadherin alpha 9
chicken(497219) protocadherin alpha 9
dog(487165) protocadherin alpha 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031857 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138661 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138661 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138661 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014005 Rosetta Predictions human pricing
NM_031857 Rosetta Predictions human pricing
NM_199508 Rosetta Predictions rat pricing
NM_138661 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185188 predicted 1386
2 SASI_Hs01_00185189 predicted 1340
3 SASI_Hs01_00185190 predicted 1390
4 SASI_Hs02_00344975 predicted 1385
5 SASI_Hs01_00185191 predicted 1483
6 SASI_Hs01_00185193 predicted 1361
7 SASI_Hs01_00185194 predicted 1380
8 SASI_Hs01_00185195 predicted 1439
9 SASI_Hs02_00344976 predicted 1414
10 SASI_Hs01_00185197 predicted 1451
11 SASI_Hs01_00185192 predicted 1413
12 SASI_Hs01_00185196 predicted 1411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229065 predicted 3715
2 SASI_Hs01_00229066 predicted 3949
3 SASI_Hs01_00229067 predicted 3362
4 SASI_Hs01_00229068 predicted 3424
5 SASI_Hs01_00229069 predicted 1541
6 SASI_Hs01_00229070 predicted 3675
7 SASI_Hs01_00229072 predicted 1560
8 SASI_Hs01_00229073 predicted 1665
9 SASI_Hs01_00229074 predicted 3672
10 SASI_Hs02_00358965 predicted 1517
11 SASI_Hs01_00229071 predicted 1639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270286 predicted 3160
2 SASI_Rn02_00270287 predicted 2069
3 SASI_Rn02_00270288 predicted 998
4 SASI_Rn02_00270289 predicted 770
5 SASI_Rn02_00270290 predicted 2687
6 SASI_Rn02_00270291 predicted 32
7 SASI_Rn02_00270292 predicted 899
8 SASI_Rn02_00270293 predicted 620
9 SASI_Rn02_00270294 predicted 793
10 SASI_Rn02_00270295 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093748 predicted 3386
2 SASI_Mm01_00093749 predicted 3283
3 SASI_Mm01_00093750 predicted 803
4 SASI_Mm02_00339720 predicted 1891
5 SASI_Mm02_00339721 predicted 1002
6 SASI_Mm01_00093752 predicted 957
7 SASI_Mm01_00093753 predicted 1005
8 SASI_Mm01_00093755 predicted 811
9 SASI_Mm01_00093757 predicted 869
10 SASI_Mm02_00339722 predicted 1210
11 SASI_Mm01_00093751 predicted 591
12 SASI_Mm01_00093754 predicted 2802
13 SASI_Mm01_00093756 predicted 1966
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031857
PCDHA9 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031857.1-3048s21c1
Sequence:CCGGGCCTTTCTCCTTGTGCTGGATCTCGAGATCCAGCACAAGGAGAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031857.1-2845s21c1
Sequence:CCGGGTCTAGCCTGTTGGTTCTCACCTCGAGGTGAGAACCAACAGGCTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031857.1-1860s21c1
Sequence:CCGGCAGATGCCAACGGGCAGGTTACTCGAGTAACCTGCCCGTTGGCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031857.1-2547s21c1
Sequence:CCGGCATACGAGCTGCAGCCAGAAACTCGAGTTTCTGGCTGCAGCTCGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-1835s1c2
Sequence:CCGGCTGATTAGTGTGATCGACCTACTCGAGTAGGTCGATCACACTAATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-906s1c2
Sequence:CCGGCGCGCCTGTTCCAGTTGGATTCTCGAGAATCCAACTGGAACAGGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-3090s1c1
Sequence:CCGGCCTCTGCTTCCTCAGATTCAACTCGAGTTGAATCTGAGGAAGCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-906s1c1
Sequence:CCGGCGCGCCTGTTCCAGTTGGATTCTCGAGAATCCAACTGGAACAGGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-1835s1c1
Sequence:CCGGCTGATTAGTGTGATCGACCTACTCGAGTAGGTCGATCACACTAATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-1569s1c1
Sequence:CCGGCCAGTGATGTTTCTCCAGATACTCGAGTATCTGGAGAAACATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031857
PCDHA9 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031857.1-3048s21c1
Sequence:CCGGGCCTTTCTCCTTGTGCTGGATCTCGAGATCCAGCACAAGGAGAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031857.1-2845s21c1
Sequence:CCGGGTCTAGCCTGTTGGTTCTCACCTCGAGGTGAGAACCAACAGGCTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031857.1-1860s21c1
Sequence:CCGGCAGATGCCAACGGGCAGGTTACTCGAGTAACCTGCCCGTTGGCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031857.1-2547s21c1
Sequence:CCGGCATACGAGCTGCAGCCAGAAACTCGAGTTTCTGGCTGCAGCTCGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-1835s1c2
Sequence:CCGGCTGATTAGTGTGATCGACCTACTCGAGTAGGTCGATCACACTAATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-906s1c2
Sequence:CCGGCGCGCCTGTTCCAGTTGGATTCTCGAGAATCCAACTGGAACAGGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-3090s1c1
Sequence:CCGGCCTCTGCTTCCTCAGATTCAACTCGAGTTGAATCTGAGGAAGCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-906s1c1
Sequence:CCGGCGCGCCTGTTCCAGTTGGATTCTCGAGAATCCAACTGGAACAGGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-1835s1c1
Sequence:CCGGCTGATTAGTGTGATCGACCTACTCGAGTAGGTCGATCACACTAATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-1569s1c1
Sequence:CCGGCCAGTGATGTTTCTCCAGATACTCGAGTATCTGGAGAAACATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031857
PCDHA9 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031857.1-3048s21c1
Sequence:CCGGGCCTTTCTCCTTGTGCTGGATCTCGAGATCCAGCACAAGGAGAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031857.1-2845s21c1
Sequence:CCGGGTCTAGCCTGTTGGTTCTCACCTCGAGGTGAGAACCAACAGGCTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031857.1-1860s21c1
Sequence:CCGGCAGATGCCAACGGGCAGGTTACTCGAGTAACCTGCCCGTTGGCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031857.1-2547s21c1
Sequence:CCGGCATACGAGCTGCAGCCAGAAACTCGAGTTTCTGGCTGCAGCTCGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-1835s1c2
Sequence:CCGGCTGATTAGTGTGATCGACCTACTCGAGTAGGTCGATCACACTAATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-906s1c2
Sequence:CCGGCGCGCCTGTTCCAGTTGGATTCTCGAGAATCCAACTGGAACAGGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-3090s1c1
Sequence:CCGGCCTCTGCTTCCTCAGATTCAACTCGAGTTGAATCTGAGGAAGCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-906s1c1
Sequence:CCGGCGCGCCTGTTCCAGTTGGATTCTCGAGAATCCAACTGGAACAGGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-1835s1c1
Sequence:CCGGCTGATTAGTGTGATCGACCTACTCGAGTAGGTCGATCACACTAATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031857.1-1569s1c1
Sequence:CCGGCCAGTGATGTTTCTCCAGATACTCGAGTATCTGGAGAAACATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138661
PCDHA9 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138661.1-3259s1c1
Sequence:CCGGGCATCCTGTCTTGATGATATTCTCGAGAATATCATCAAGACAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138661.1-1130s1c1
Sequence:CCGGCACCGGAGATAGTCCTTACTTCTCGAGAAGTAAGGACTATCTCCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138661.1-2158s1c1
Sequence:CCGGGCGTCGCTGATGGATGTCAATCTCGAGATTGACATCCATCAGCGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138661.1-748s1c1
Sequence:CCGGCCTGAATTTACGGGATCGGTTCTCGAGAACCGATCCCGTAAATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138661.1-831s1c1
Sequence:CCGGCGAAGTTAAGATGTATGAGAACTCGAGTTCTCATACATCTTAACTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138661
PCDHA9 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138661.1-3259s1c1
Sequence:CCGGGCATCCTGTCTTGATGATATTCTCGAGAATATCATCAAGACAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138661.1-1130s1c1
Sequence:CCGGCACCGGAGATAGTCCTTACTTCTCGAGAAGTAAGGACTATCTCCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138661.1-2158s1c1
Sequence:CCGGGCGTCGCTGATGGATGTCAATCTCGAGATTGACATCCATCAGCGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138661.1-748s1c1
Sequence:CCGGCCTGAATTTACGGGATCGGTTCTCGAGAACCGATCCCGTAAATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138661.1-831s1c1
Sequence:CCGGCGAAGTTAAGATGTATGAGAACTCGAGTTCTCATACATCTTAACTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138661
PCDHA9 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138661.1-3259s1c1
Sequence:CCGGGCATCCTGTCTTGATGATATTCTCGAGAATATCATCAAGACAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138661.1-1130s1c1
Sequence:CCGGCACCGGAGATAGTCCTTACTTCTCGAGAAGTAAGGACTATCTCCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138661.1-2158s1c1
Sequence:CCGGGCGTCGCTGATGGATGTCAATCTCGAGATTGACATCCATCAGCGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138661.1-748s1c1
Sequence:CCGGCCTGAATTTACGGGATCGGTTCTCGAGAACCGATCCCGTAAATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138661.1-831s1c1
Sequence:CCGGCGAAGTTAAGATGTATGAGAACTCGAGTTCTCATACATCTTAACTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)