EMAIL THIS PAGE TO A FRIEND

PCDHAC1

protocadherin alpha subfamily C, 1

240 Gene Product Result for
Synonyms: PCDH-ALPHA-C1
UniProtKB ID: Q9H158, Q9Y5F5, Q9Y5I5
Gene ID:
Human(56135) Summary: This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Mouse(353236) protocadherin alpha subfamily C, 1
Rat(393091) protocadherin alpha subfamily C, 1
cow(513302) protocadherin alpha subfamily C, 1
sheep(101123117) protocadherin alpha subfamily C, 1
domestic guinea pig(100717129) protocadherin alpha subfamily C, 1
naked mole-rat(101704585) protocadherin alpha subfamily C, 1
chicken(768577) protocadherin alpha subfamily C, 1
domestic cat(101093490) protocadherin alpha subfamily C, 1
dog(100686974) protocadherin alpha subfamily C, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018898 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018898 Rosetta Predictions human pricing
NM_031882 Rosetta Predictions human pricing
NM_199509 Rosetta Predictions rat pricing
NM_001003671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059246 predicted 2039
2 SASI_Hs02_00352324 predicted 642
3 SASI_Hs01_00059247 predicted 1051
4 SASI_Hs01_00059248 predicted 315
5 SASI_Hs01_00059249 predicted 1294
6 SASI_Hs01_00059250 predicted 2221
7 SASI_Hs01_00059251 predicted 1559
8 SASI_Hs01_00059252 predicted 1015
9 SASI_Hs01_00059254 predicted 1815
10 SASI_Hs01_00059255 predicted 1262
11 SASI_Hs01_00059253 predicted 1987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172866 predicted 2033
2 SASI_Hs02_00358988 predicted 645
3 SASI_Hs01_00172867 predicted 1050
4 SASI_Hs01_00172868 predicted 316
5 SASI_Hs01_00172869 predicted 1297
6 SASI_Hs01_00172870 predicted 2222
7 SASI_Hs01_00172871 predicted 1557
8 SASI_Hs01_00172872 predicted 1024
9 SASI_Hs01_00172874 predicted 1818
10 SASI_Hs01_00172875 predicted 1264
11 SASI_Hs01_00172873 predicted 1994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199509 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063460 predicted 3216
2 SASI_Rn01_00063461 predicted 3028
3 SASI_Rn01_00063462 predicted 901
4 SASI_Rn01_00063463 predicted 440
5 SASI_Rn01_00063464 predicted 955
6 SASI_Rn01_00063465 predicted 2741
7 SASI_Rn01_00063467 predicted 1144
8 SASI_Rn02_00270296 predicted 2367
9 SASI_Rn01_00063468 predicted 93
10 SASI_Rn01_00063469 predicted 1941
11 SASI_Rn01_00063466 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034717 predicted 3336
2 SASI_Mm01_00034718 predicted 3244
3 SASI_Mm02_00286322 predicted 3307
4 SASI_Mm01_00034719 predicted 331
5 SASI_Mm01_00034720 predicted 282
6 SASI_Mm01_00034722 predicted 136
7 SASI_Mm01_00034723 predicted 686
8 SASI_Mm01_00034724 predicted 2191
9 SASI_Mm01_00034725 predicted 909
10 SASI_Mm01_00034726 predicted 702
11 SASI_Mm01_00034721 predicted 2748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018898
PCDHAC1 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha subfamily C, 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-2157s1c1
Sequence:CCGGCCTCAGTTACTTCCAGACTTTCTCGAGAAAGTCTGGAAGTAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-331s1c1
Sequence:CCGGCGCGGAACTTTCGCTTCCTTTCTCGAGAAAGGAAGCGAAAGTTCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-1984s1c1
Sequence:CCGGCGTCTGACTCTAGTCTCTTTACTCGAGTAAAGAGACTAGAGTCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-2549s1c1
Sequence:CCGGGCCAATATCCTGTATTCAGATCTCGAGATCTGAATACAGGATATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-1243s1c1
Sequence:CCGGGCACAGTGATTGCTCTCTTTACTCGAGTAAAGAGAGCAATCACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-1984s1c2
Sequence:CCGGCGTCTGACTCTAGTCTCTTTACTCGAGTAAAGAGACTAGAGTCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018898.3-1272s21c1
Sequence:CCGGGATGAAGACCTCGATTCTAATCTCGAGATTAGAATCGAGGTCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018898.3-1820s21c1
Sequence:CCGGGAATGACAATTATCCGGTTATCTCGAGATAACCGGATAATTGTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018898.3-869s21c1
Sequence:CCGGTGTATTTGAGCGCTCCGTATACTCGAGTATACGGAGCGCTCAAATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018898.3-2229s21c1
Sequence:CCGGGTAATTGCCTTGGCTTGTATTCTCGAGAATACAAGCCAAGGCAATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018898
PCDHAC1 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha subfamily C, 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-2157s1c1
Sequence:CCGGCCTCAGTTACTTCCAGACTTTCTCGAGAAAGTCTGGAAGTAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-331s1c1
Sequence:CCGGCGCGGAACTTTCGCTTCCTTTCTCGAGAAAGGAAGCGAAAGTTCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-1984s1c1
Sequence:CCGGCGTCTGACTCTAGTCTCTTTACTCGAGTAAAGAGACTAGAGTCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-2549s1c1
Sequence:CCGGGCCAATATCCTGTATTCAGATCTCGAGATCTGAATACAGGATATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-1243s1c1
Sequence:CCGGGCACAGTGATTGCTCTCTTTACTCGAGTAAAGAGAGCAATCACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-1984s1c2
Sequence:CCGGCGTCTGACTCTAGTCTCTTTACTCGAGTAAAGAGACTAGAGTCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018898.3-1272s21c1
Sequence:CCGGGATGAAGACCTCGATTCTAATCTCGAGATTAGAATCGAGGTCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018898.3-1820s21c1
Sequence:CCGGGAATGACAATTATCCGGTTATCTCGAGATAACCGGATAATTGTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018898.3-869s21c1
Sequence:CCGGTGTATTTGAGCGCTCCGTATACTCGAGTATACGGAGCGCTCAAATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018898.3-2229s21c1
Sequence:CCGGGTAATTGCCTTGGCTTGTATTCTCGAGAATACAAGCCAAGGCAATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018898
PCDHAC1 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha subfamily C, 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-2157s1c1
Sequence:CCGGCCTCAGTTACTTCCAGACTTTCTCGAGAAAGTCTGGAAGTAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-331s1c1
Sequence:CCGGCGCGGAACTTTCGCTTCCTTTCTCGAGAAAGGAAGCGAAAGTTCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-1984s1c1
Sequence:CCGGCGTCTGACTCTAGTCTCTTTACTCGAGTAAAGAGACTAGAGTCAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-2549s1c1
Sequence:CCGGGCCAATATCCTGTATTCAGATCTCGAGATCTGAATACAGGATATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-1243s1c1
Sequence:CCGGGCACAGTGATTGCTCTCTTTACTCGAGTAAAGAGAGCAATCACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018898.3-1984s1c2
Sequence:CCGGCGTCTGACTCTAGTCTCTTTACTCGAGTAAAGAGACTAGAGTCAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018898.3-1272s21c1
Sequence:CCGGGATGAAGACCTCGATTCTAATCTCGAGATTAGAATCGAGGTCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018898.3-1820s21c1
Sequence:CCGGGAATGACAATTATCCGGTTATCTCGAGATAACCGGATAATTGTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018898.3-869s21c1
Sequence:CCGGTGTATTTGAGCGCTCCGTATACTCGAGTATACGGAGCGCTCAAATACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018898.3-2229s21c1
Sequence:CCGGGTAATTGCCTTGGCTTGTATTCTCGAGAATACAAGCCAAGGCAATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003671
PCDHAC1 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha subfamily C, 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003671.1-2133s1c1
Sequence:CCGGCCCAGATTGTTGCTCTCAGAACTCGAGTTCTGAGAGCAACAATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003671.1-95s1c1
Sequence:CCGGCGGGAGTTACTGTAGGCAATACTCGAGTATTGCCTACAGTAACTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003671.1-1067s1c1
Sequence:CCGGGCACAGTGATTGCTCTCCTTACTCGAGTAAGGAGAGCAATCACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003671.1-2038s1c1
Sequence:CCGGGCCCGGAACTTGTACTTGATACTCGAGTATCAAGTACAAGTTCCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003671.1-4815s1c1
Sequence:CCGGGCACAACTTAGATGTTTGATTCTCGAGAATCAAACATCTAAGTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003671
PCDHAC1 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha subfamily C, 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003671.1-2133s1c1
Sequence:CCGGCCCAGATTGTTGCTCTCAGAACTCGAGTTCTGAGAGCAACAATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003671.1-95s1c1
Sequence:CCGGCGGGAGTTACTGTAGGCAATACTCGAGTATTGCCTACAGTAACTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003671.1-1067s1c1
Sequence:CCGGGCACAGTGATTGCTCTCCTTACTCGAGTAAGGAGAGCAATCACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003671.1-2038s1c1
Sequence:CCGGGCCCGGAACTTGTACTTGATACTCGAGTATCAAGTACAAGTTCCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003671.1-4815s1c1
Sequence:CCGGGCACAACTTAGATGTTTGATTCTCGAGAATCAAACATCTAAGTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003671
PCDHAC1 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha subfamily C, 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003671.1-2133s1c1
Sequence:CCGGCCCAGATTGTTGCTCTCAGAACTCGAGTTCTGAGAGCAACAATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003671.1-95s1c1
Sequence:CCGGCGGGAGTTACTGTAGGCAATACTCGAGTATTGCCTACAGTAACTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003671.1-1067s1c1
Sequence:CCGGGCACAGTGATTGCTCTCCTTACTCGAGTAAGGAGAGCAATCACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003671.1-2038s1c1
Sequence:CCGGGCCCGGAACTTGTACTTGATACTCGAGTATCAAGTACAAGTTCCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003671.1-4815s1c1
Sequence:CCGGGCACAACTTAGATGTTTGATTCTCGAGAATCAAACATCTAAGTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)