EMAIL THIS PAGE TO A FRIEND

PCDHAC2

protocadherin alpha subfamily C, 2

232 Gene Product Result for
Synonyms: PCDH-ALPHA-C2
UniProtKB ID: Q9Y5I4, Q2M3V1, Q9Y5F4
Gene ID:
Human(56134) Summary: This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Mouse(353237) protocadherin alpha subfamily C, 2
Rat(393092) protocadherin alpha subfamily C, 2
Zebrafish(100535313) protocadherin alpha subfamily C, 2
Horse(100146554) protocadherin alpha subfamily C, 2
chicken(497224) protocadherin alpha subfamily C, 2
domestic cat(101098920) protocadherin alpha subfamily C, 2
dog(478037) protocadherin alpha subfamily C, 2
naked mole-rat(101703754) protocadherin alpha subfamily C, 2
Domestic Rabbit(100352395) protocadherin alpha subfamily C, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003672 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003672 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003672 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018899 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113991 MISSION® esiRNA esiRNA human PCDHAC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018899 Rosetta Predictions human pricing
NM_031883 Rosetta Predictions human pricing
NM_201422 Rosetta Predictions rat pricing
NM_001003672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192558 predicted 1649
2 SASI_Hs01_00192559 predicted 2367
3 SASI_Hs01_00192560 predicted 1831
4 SASI_Hs01_00192562 predicted 2353
5 SASI_Hs01_00192563 predicted 1378
6 SASI_Hs01_00192564 predicted 1938
7 SASI_Hs01_00192565 predicted 1851
8 SASI_Hs01_00192566 predicted 2115
9 SASI_Hs01_00192567 predicted 2105
10 SASI_Hs02_00352325 predicted 2521
11 SASI_Hs01_00192561 predicted 2366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056665 predicted 1415
2 SASI_Hs01_00056666 predicted 2122
3 SASI_Hs01_00056667 predicted 1588
4 SASI_Hs01_00056669 predicted 2110
5 SASI_Hs01_00056670 predicted 1142
6 SASI_Hs01_00056671 predicted 1695
7 SASI_Hs01_00056672 predicted 1614
8 SASI_Hs01_00056673 predicted 1871
9 SASI_Hs01_00056674 predicted 1863
10 SASI_Hs02_00358989 predicted 2285
11 SASI_Hs01_00056668 predicted 2123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030918 predicted 3345
2 SASI_Rn01_00030919 predicted 3161
3 SASI_Rn01_00030920 predicted 1166
4 SASI_Rn01_00030921 predicted 2101
5 SASI_Rn01_00030922 predicted 2156
6 SASI_Rn01_00030923 predicted 2871
7 SASI_Rn01_00030924 predicted 2479
8 SASI_Rn01_00030926 predicted 2111
9 SASI_Rn02_00270319 predicted 565
10 SASI_Rn01_00030927 predicted 367
11 SASI_Rn01_00030925 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050263 predicted 3468
2 SASI_Mm01_00050264 predicted 3368
3 SASI_Mm01_00050265 predicted 1686
4 SASI_Mm01_00050266 predicted 2108
5 SASI_Mm02_00286323 predicted 1826
6 SASI_Mm01_00050268 predicted 563
7 SASI_Mm02_00286324 predicted 945
8 SASI_Mm01_00050269 predicted 718
9 SASI_Mm01_00050271 predicted 1406
10 SASI_Mm01_00050272 predicted 2487
11 SASI_Mm01_00050267 predicted 2296
12 SASI_Mm01_00050270 predicted 2883
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003672
PCDHAC2 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha subfamily C, 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003672.1-2320s1c1
Sequence:CCGGCAGCCTCACTTCATTGAGGTTCTCGAGAACCTCAATGAAGTGAGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003672.1-1811s1c1
Sequence:CCGGCCAAAGTCATAGCCATGGATTCTCGAGAATCCATGGCTATGACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003672.1-4872s1c1
Sequence:CCGGCGGAATATCAGCTTGTAGAAACTCGAGTTTCTACAAGCTGATATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003672.1-2310s1c1
Sequence:CCGGCCTCAAAGTACAGCCTCACTTCTCGAGAAGTGAGGCTGTACTTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003672.1-448s1c1
Sequence:CCGGCCGGATTATCAGCTTCAGGTACTCGAGTACCTGAAGCTGATAATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003672
PCDHAC2 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha subfamily C, 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003672.1-2320s1c1
Sequence:CCGGCAGCCTCACTTCATTGAGGTTCTCGAGAACCTCAATGAAGTGAGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003672.1-1811s1c1
Sequence:CCGGCCAAAGTCATAGCCATGGATTCTCGAGAATCCATGGCTATGACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003672.1-4872s1c1
Sequence:CCGGCGGAATATCAGCTTGTAGAAACTCGAGTTTCTACAAGCTGATATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003672.1-2310s1c1
Sequence:CCGGCCTCAAAGTACAGCCTCACTTCTCGAGAAGTGAGGCTGTACTTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003672.1-448s1c1
Sequence:CCGGCCGGATTATCAGCTTCAGGTACTCGAGTACCTGAAGCTGATAATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003672
PCDHAC2 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha subfamily C, 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003672.1-2320s1c1
Sequence:CCGGCAGCCTCACTTCATTGAGGTTCTCGAGAACCTCAATGAAGTGAGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003672.1-1811s1c1
Sequence:CCGGCCAAAGTCATAGCCATGGATTCTCGAGAATCCATGGCTATGACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003672.1-4872s1c1
Sequence:CCGGCGGAATATCAGCTTGTAGAAACTCGAGTTTCTACAAGCTGATATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003672.1-2310s1c1
Sequence:CCGGCCTCAAAGTACAGCCTCACTTCTCGAGAAGTGAGGCTGTACTTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003672.1-448s1c1
Sequence:CCGGCCGGATTATCAGCTTCAGGTACTCGAGTACCTGAAGCTGATAATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018899
VALIDATED
PCDHAC2 MISSION shRNA Bacterial Glycerol Stock
protocadherin alpha subfamily C, 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018899.3-2092s1c1
Sequence:CCGGCCTCGGACATACTCTGAAATTCTCGAGAATTTCAGAGTATGTCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018899.3-1230s1c1
Sequence:CCGGCCGACTGAATGGCTTTGGAAACTCGAGTTTCCAAAGCCATTCAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018899.3-1356s1c1
Sequence:CCGGGCGTACACTGAAGGTTGAGATCTCGAGATCTCAACCTTCAGTGTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018899.3-1597s1c1
Sequence:CCGGGCTGTCAACTCCTTTGACTATCTCGAGATAGTCAAAGGAGTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018899.3-2231s1c1
Sequence:CCGGGCTTCTGTGGAGTAAGGGAAACTCGAGTTTCCCTTACTCCACAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018899
VALIDATED
PCDHAC2 MISSION shRNA shRNA Plasmid DNA
protocadherin alpha subfamily C, 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018899.3-2092s1c1
Sequence:CCGGCCTCGGACATACTCTGAAATTCTCGAGAATTTCAGAGTATGTCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018899.3-1230s1c1
Sequence:CCGGCCGACTGAATGGCTTTGGAAACTCGAGTTTCCAAAGCCATTCAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018899.3-1356s1c1
Sequence:CCGGGCGTACACTGAAGGTTGAGATCTCGAGATCTCAACCTTCAGTGTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018899.3-1597s1c1
Sequence:CCGGGCTGTCAACTCCTTTGACTATCTCGAGATAGTCAAAGGAGTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018899.3-2231s1c1
Sequence:CCGGGCTTCTGTGGAGTAAGGGAAACTCGAGTTTCCCTTACTCCACAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018899
VALIDATED
PCDHAC2 MISSION shRNA Lentiviral Transduction Particles
protocadherin alpha subfamily C, 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018899.3-2092s1c1
Sequence:CCGGCCTCGGACATACTCTGAAATTCTCGAGAATTTCAGAGTATGTCCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018899.3-1230s1c1
Sequence:CCGGCCGACTGAATGGCTTTGGAAACTCGAGTTTCCAAAGCCATTCAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018899.3-1356s1c1
Sequence:CCGGGCGTACACTGAAGGTTGAGATCTCGAGATCTCAACCTTCAGTGTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018899.3-1597s1c1
Sequence:CCGGGCTGTCAACTCCTTTGACTATCTCGAGATAGTCAAAGGAGTTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018899.3-2231s1c1
Sequence:CCGGGCTTCTGTGGAGTAAGGGAAACTCGAGTTTCCCTTACTCCACAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)