EMAIL THIS PAGE TO A FRIEND

PCDHB10

protocadherin beta 10

54 Gene Product Result for
Synonyms: PCDH-BETA10 PCHB10
UniProtKB ID: Q9UN67, Q96T99
Gene ID:
Human(56126) Summary: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Mouse(93881) protocadherin beta 10
Rat(291649) protocadherin beta 10
sheep(101103233) protocadherin beta 10
domestic cat(101095224) protocadherin beta 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018930 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018930 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018930 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053135 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053135 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053135 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU163771 MISSION® esiRNA esiRNA targeting mouse Pcdhb10 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018930 Rosetta Predictions human pricing
NM_001114603 Rosetta Predictions rat pricing
XM_001055526 Rosetta Predictions rat pricing
NM_053135 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130783 predicted 1173
2 SASI_Hs02_00352383 predicted 968
3 SASI_Hs02_00352384 predicted 1226
4 SASI_Hs01_00130789 predicted 2485
5 SASI_Hs01_00130790 predicted 2472
6 SASI_Hs02_00352385 predicted 1334
7 SASI_Hs02_00352386 predicted 2462
8 SASI_Hs02_00352387 predicted 1305
9 SASI_Hs01_00130785 predicted 1307
10 SASI_Hs02_00352388 predicted 567
11 SASI_Hs01_00130781 predicted 724
12 SASI_Hs01_00130782 predicted 1094
13 SASI_Hs01_00130784 predicted 743
14 SASI_Hs01_00130786 predicted 298
15 SASI_Hs01_00130787 predicted 1106
16 SASI_Hs01_00130788 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252313 predicted 973
2 SASI_Rn02_00252314 predicted 198
3 SASI_Rn02_00252315 predicted 1182
4 SASI_Rn02_00252316 predicted 1592
5 SASI_Rn02_00252317 predicted 273
6 SASI_Rn02_00252318 predicted 1609
7 SASI_Rn02_00252319 predicted 769
8 SASI_Rn02_00252320 predicted 961
9 SASI_Rn02_00252321 predicted 282
10 SASI_Rn02_00252322 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279865 predicted 973
2 SASI_Rn02_00279866 predicted 202
3 SASI_Rn02_00279867 predicted 1190
4 SASI_Rn02_00279868 predicted 1590
5 SASI_Rn02_00279869 predicted 269
6 SASI_Rn02_00279870 predicted 1609
7 SASI_Rn02_00279871 predicted 766
8 SASI_Rn02_00279872 predicted 968
9 SASI_Rn02_00279873 predicted 281
10 SASI_Rn02_00279874 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171579 predicted 1934
2 SASI_Mm01_00171580 predicted 1032
3 SASI_Mm01_00171581 predicted 585
4 SASI_Mm01_00171582 predicted 1236
5 SASI_Mm01_00171583 predicted 1127
6 SASI_Mm01_00171584 predicted 1025
7 SASI_Mm02_00337653 predicted 2445
8 SASI_Mm02_00337654 predicted 2440
9 SASI_Mm01_00171585 predicted 2241
10 SASI_Mm01_00171586 predicted 1233
11 SASI_Mm01_00171587 predicted 938
12 SASI_Mm01_00171588 predicted 1196
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018930
PCDHB10 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018930.3-992s21c1
Sequence:CCGGTCAACGCGGAAGTATCCTATTCTCGAGAATAGGATACTTCCGCGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018930.3-2905s21c1
Sequence:CCGGATAGTGTACTTGCTCTATTTACTCGAGTAAATAGAGCAAGTACACTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018930.3-863s21c1
Sequence:CCGGTCGTTGTCTTGGACGTCAATGCTCGAGCATTGACGTCCAAGACAACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018930.3-2661s21c1
Sequence:CCGGATTATGCAACTTCAAGCATTACTCGAGTAATGCTTGAAGTTGCATAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018930.3-2613s21c1
Sequence:CCGGACATAGCCATGTTTCTATTAGCTCGAGCTAATAGAAACATGGCTATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018930.2-388s1c1
Sequence:CCGGGCGCCAGTATTTCAGGACAAACTCGAGTTTGTCCTGAAATACTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018930.2-2307s1c1
Sequence:CCGGGAAACCAGTTATTTCGGATATCTCGAGATATCCGAAATAACTGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018930.2-1144s1c1
Sequence:CCGGGTTTGCTACATTCAAGAGAATCTCGAGATTCTCTTGAATGTAGCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018930.2-1003s1c1
Sequence:CCGGGTGGAAGTATTGGACACCAATCTCGAGATTGGTGTCCAATACTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018930.2-766s1c1
Sequence:CCGGCCCATTGGGTTCCTTATTGTTCTCGAGAACAATAAGGAACCCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018930
PCDHB10 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018930.3-992s21c1
Sequence:CCGGTCAACGCGGAAGTATCCTATTCTCGAGAATAGGATACTTCCGCGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018930.3-2905s21c1
Sequence:CCGGATAGTGTACTTGCTCTATTTACTCGAGTAAATAGAGCAAGTACACTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018930.3-863s21c1
Sequence:CCGGTCGTTGTCTTGGACGTCAATGCTCGAGCATTGACGTCCAAGACAACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018930.3-2661s21c1
Sequence:CCGGATTATGCAACTTCAAGCATTACTCGAGTAATGCTTGAAGTTGCATAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018930.3-2613s21c1
Sequence:CCGGACATAGCCATGTTTCTATTAGCTCGAGCTAATAGAAACATGGCTATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018930.2-388s1c1
Sequence:CCGGGCGCCAGTATTTCAGGACAAACTCGAGTTTGTCCTGAAATACTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018930.2-2307s1c1
Sequence:CCGGGAAACCAGTTATTTCGGATATCTCGAGATATCCGAAATAACTGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018930.2-1144s1c1
Sequence:CCGGGTTTGCTACATTCAAGAGAATCTCGAGATTCTCTTGAATGTAGCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018930.2-1003s1c1
Sequence:CCGGGTGGAAGTATTGGACACCAATCTCGAGATTGGTGTCCAATACTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018930.2-766s1c1
Sequence:CCGGCCCATTGGGTTCCTTATTGTTCTCGAGAACAATAAGGAACCCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018930
PCDHB10 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018930.3-992s21c1
Sequence:CCGGTCAACGCGGAAGTATCCTATTCTCGAGAATAGGATACTTCCGCGTTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018930.3-2905s21c1
Sequence:CCGGATAGTGTACTTGCTCTATTTACTCGAGTAAATAGAGCAAGTACACTATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018930.3-863s21c1
Sequence:CCGGTCGTTGTCTTGGACGTCAATGCTCGAGCATTGACGTCCAAGACAACGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018930.3-2661s21c1
Sequence:CCGGATTATGCAACTTCAAGCATTACTCGAGTAATGCTTGAAGTTGCATAATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018930.3-2613s21c1
Sequence:CCGGACATAGCCATGTTTCTATTAGCTCGAGCTAATAGAAACATGGCTATGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018930.2-388s1c1
Sequence:CCGGGCGCCAGTATTTCAGGACAAACTCGAGTTTGTCCTGAAATACTGGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018930.2-2307s1c1
Sequence:CCGGGAAACCAGTTATTTCGGATATCTCGAGATATCCGAAATAACTGGTTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018930.2-1144s1c1
Sequence:CCGGGTTTGCTACATTCAAGAGAATCTCGAGATTCTCTTGAATGTAGCAAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018930.2-1003s1c1
Sequence:CCGGGTGGAAGTATTGGACACCAATCTCGAGATTGGTGTCCAATACTTCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018930.2-766s1c1
Sequence:CCGGCCCATTGGGTTCCTTATTGTTCTCGAGAACAATAAGGAACCCAATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053135
PCDHB10 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053135.1-2064s1c1
Sequence:CCGGGCTGTACTTGGTCATTGCTTTCTCGAGAAAGCAATGACCAAGTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053135.1-932s1c1
Sequence:CCGGCTCCGTATTATAACATGGAAACTCGAGTTTCCATGTTATAATACGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053135.1-931s1c1
Sequence:CCGGACTCCGTATTATAACATGGAACTCGAGTTCCATGTTATAATACGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053135.1-240s1c1
Sequence:CCGGGACTGGGAATTTATTCCTGAACTCGAGTTCAGGAATAAATTCCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053135.1-1498s1c1
Sequence:CCGGACCTCTCTTGTCTCCATCAATCTCGAGATTGATGGAGACAAGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053135
PCDHB10 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053135.1-2064s1c1
Sequence:CCGGGCTGTACTTGGTCATTGCTTTCTCGAGAAAGCAATGACCAAGTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053135.1-932s1c1
Sequence:CCGGCTCCGTATTATAACATGGAAACTCGAGTTTCCATGTTATAATACGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053135.1-931s1c1
Sequence:CCGGACTCCGTATTATAACATGGAACTCGAGTTCCATGTTATAATACGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053135.1-240s1c1
Sequence:CCGGGACTGGGAATTTATTCCTGAACTCGAGTTCAGGAATAAATTCCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053135.1-1498s1c1
Sequence:CCGGACCTCTCTTGTCTCCATCAATCTCGAGATTGATGGAGACAAGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053135
PCDHB10 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053135.1-2064s1c1
Sequence:CCGGGCTGTACTTGGTCATTGCTTTCTCGAGAAAGCAATGACCAAGTACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053135.1-932s1c1
Sequence:CCGGCTCCGTATTATAACATGGAAACTCGAGTTTCCATGTTATAATACGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053135.1-931s1c1
Sequence:CCGGACTCCGTATTATAACATGGAACTCGAGTTCCATGTTATAATACGGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053135.1-240s1c1
Sequence:CCGGGACTGGGAATTTATTCCTGAACTCGAGTTCAGGAATAAATTCCCAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053135.1-1498s1c1
Sequence:CCGGACCTCTCTTGTCTCCATCAATCTCGAGATTGATGGAGACAAGAGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)