EMAIL THIS PAGE TO A FRIEND

PCDHB11

protocadherin beta 11

57 Gene Product Result for
Synonyms: ME2 PCDH-BETA11
UniProtKB ID: Q9Y5F2, Q2M223
Gene ID:
Human(56125) Summary: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Mouse(93882) protocadherin beta 11
Rat(291648) protocadherin beta 11
dog(487176) protocadherin beta 11
cow(515336) protocadherin beta 11
sheep(101102062) protocadherin beta 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018931 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018931 Rosetta Predictions human pricing
XM_001055576 Rosetta Predictions rat pricing
XM_001064927 Rosetta Predictions rat pricing
NM_053136 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108501 predicted 816
2 SASI_Hs01_00108502 predicted 1008
3 SASI_Hs01_00108503 predicted 816
4 SASI_Hs01_00108504 predicted 1304
5 SASI_Hs01_00108505 predicted 816
6 SASI_Hs01_00108506 predicted 2270
7 SASI_Hs01_00108508 predicted 807
8 SASI_Hs01_00108509 predicted 2297
9 SASI_Hs01_00108510 predicted 78
10 SASI_Hs02_00352389 predicted 2460
11 SASI_Hs01_00108507 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280132 predicted 1129
2 SASI_Rn02_00280133 predicted 727
3 SASI_Rn02_00280134 predicted 2267
4 SASI_Rn02_00280135 predicted 997
5 SASI_Rn02_00280136 predicted 479
6 SASI_Rn02_00280137 predicted 1683
7 SASI_Rn02_00280138 predicted 2240
8 SASI_Rn02_00280139 predicted 922
9 SASI_Rn02_00280140 predicted 1736
10 SASI_Rn02_00280141 predicted 2388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312265 predicted 1129
2 SASI_Rn02_00312266 predicted 726
3 SASI_Rn02_00312267 predicted 2270
4 SASI_Rn02_00312268 predicted 996
5 SASI_Rn02_00312269 predicted 475
6 SASI_Rn02_00312270 predicted 1685
7 SASI_Rn02_00312271 predicted 2243
8 SASI_Rn02_00312272 predicted 924
9 SASI_Rn02_00312273 predicted 1735
10 SASI_Rn02_00312274 predicted 2393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133943 predicted 2589
2 SASI_Mm01_00133944 predicted 2592
3 SASI_Mm01_00133945 predicted 2503
4 SASI_Mm01_00133946 predicted 718
5 SASI_Mm01_00133947 predicted 2644
6 SASI_Mm01_00133948 predicted 2637
7 SASI_Mm01_00133949 predicted 867
8 SASI_Mm01_00133950 predicted 2309
9 SASI_Mm01_00133951 predicted 965
10 SASI_Mm01_00133952 predicted 2676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018931
PCDHB11 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018931.2-306s1c1
Sequence:CCGGCGTGCTACATTTGCAGGTGTTCTCGAGAACACCTGCAAATGTAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018931.2-1134s1c1
Sequence:CCGGCGGAAGAATTGTTTGTTCCATCTCGAGATGGAACAAACAATTCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018931.2-2335s1c1
Sequence:CCGGCTTGGGAAGAATAGTGAAGAACTCGAGTTCTTCACTATTCTTCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018931.2-1008s1c1
Sequence:CCGGCGTGATAGATGTAAATGACAACTCGAGTTGTCATTTACATCTATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018931.2-203s1c1
Sequence:CCGGCTAATGATAAGAAACAGCGTTCTCGAGAACGCTGTTTCTTATCATTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018931.2-2478s21c1
Sequence:CCGGATTATGCAATACGACTAATTGCTCGAGCAATTAGTCGTATTGCATAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018931.2-1077s21c1
Sequence:CCGGTACGCCAGAGACCGTGGTTATCTCGAGATAACCACGGTCTCTGGCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018931.2-360s21c1
Sequence:CCGGGCTTCAGGTCAGGGATATAAACTCGAGTTTATATCCCTGACCTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018931
PCDHB11 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018931.2-306s1c1
Sequence:CCGGCGTGCTACATTTGCAGGTGTTCTCGAGAACACCTGCAAATGTAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018931.2-1134s1c1
Sequence:CCGGCGGAAGAATTGTTTGTTCCATCTCGAGATGGAACAAACAATTCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018931.2-2335s1c1
Sequence:CCGGCTTGGGAAGAATAGTGAAGAACTCGAGTTCTTCACTATTCTTCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018931.2-1008s1c1
Sequence:CCGGCGTGATAGATGTAAATGACAACTCGAGTTGTCATTTACATCTATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018931.2-203s1c1
Sequence:CCGGCTAATGATAAGAAACAGCGTTCTCGAGAACGCTGTTTCTTATCATTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018931.2-2478s21c1
Sequence:CCGGATTATGCAATACGACTAATTGCTCGAGCAATTAGTCGTATTGCATAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018931.2-1077s21c1
Sequence:CCGGTACGCCAGAGACCGTGGTTATCTCGAGATAACCACGGTCTCTGGCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018931.2-360s21c1
Sequence:CCGGGCTTCAGGTCAGGGATATAAACTCGAGTTTATATCCCTGACCTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018931
PCDHB11 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018931.2-306s1c1
Sequence:CCGGCGTGCTACATTTGCAGGTGTTCTCGAGAACACCTGCAAATGTAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018931.2-1134s1c1
Sequence:CCGGCGGAAGAATTGTTTGTTCCATCTCGAGATGGAACAAACAATTCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018931.2-2335s1c1
Sequence:CCGGCTTGGGAAGAATAGTGAAGAACTCGAGTTCTTCACTATTCTTCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018931.2-1008s1c1
Sequence:CCGGCGTGATAGATGTAAATGACAACTCGAGTTGTCATTTACATCTATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018931.2-203s1c1
Sequence:CCGGCTAATGATAAGAAACAGCGTTCTCGAGAACGCTGTTTCTTATCATTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018931.2-2478s21c1
Sequence:CCGGATTATGCAATACGACTAATTGCTCGAGCAATTAGTCGTATTGCATAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018931.2-1077s21c1
Sequence:CCGGTACGCCAGAGACCGTGGTTATCTCGAGATAACCACGGTCTCTGGCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018931.2-360s21c1
Sequence:CCGGGCTTCAGGTCAGGGATATAAACTCGAGTTTATATCCCTGACCTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053136
PCDHB11 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053136.2-2866s1c1
Sequence:CCGGGCCATCACTGAATTAAGATATCTCGAGATATCTTAATTCAGTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053136.2-1126s1c1
Sequence:CCGGCGAGGGAATTAGCCATTATAACTCGAGTTATAATGGCTAATTCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053136.2-2317s1c1
Sequence:CCGGTGTCCTTATGTTTGTGGGAATCTCGAGATTCCCACAAACATAAGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053136.2-1116s1c1
Sequence:CCGGAGCTGGATTTCGAGGGAATTACTCGAGTAATTCCCTCGAAATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053136.2-968s1c1
Sequence:CCGGCCCATTGATACCTTAGTTGTTCTCGAGAACAACTAAGGTATCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053136
PCDHB11 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053136.2-2866s1c1
Sequence:CCGGGCCATCACTGAATTAAGATATCTCGAGATATCTTAATTCAGTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053136.2-1126s1c1
Sequence:CCGGCGAGGGAATTAGCCATTATAACTCGAGTTATAATGGCTAATTCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053136.2-2317s1c1
Sequence:CCGGTGTCCTTATGTTTGTGGGAATCTCGAGATTCCCACAAACATAAGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053136.2-1116s1c1
Sequence:CCGGAGCTGGATTTCGAGGGAATTACTCGAGTAATTCCCTCGAAATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053136.2-968s1c1
Sequence:CCGGCCCATTGATACCTTAGTTGTTCTCGAGAACAACTAAGGTATCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053136
PCDHB11 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053136.2-2866s1c1
Sequence:CCGGGCCATCACTGAATTAAGATATCTCGAGATATCTTAATTCAGTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053136.2-1126s1c1
Sequence:CCGGCGAGGGAATTAGCCATTATAACTCGAGTTATAATGGCTAATTCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053136.2-2317s1c1
Sequence:CCGGTGTCCTTATGTTTGTGGGAATCTCGAGATTCCCACAAACATAAGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053136.2-1116s1c1
Sequence:CCGGAGCTGGATTTCGAGGGAATTACTCGAGTAATTCCCTCGAAATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053136.2-968s1c1
Sequence:CCGGCCCATTGATACCTTAGTTGTTCTCGAGAACAACTAAGGTATCAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)