EMAIL THIS PAGE TO A FRIEND

PCDHB12

protocadherin beta 12

53 Gene Product Result for
Synonyms: PCDH-BETA12
UniProtKB ID: Q9Y5F1
Gene ID:
Human(56124) Summary: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Mouse(93883) protocadherin beta 12
Rat(25133) protocadherin beta 12
Domestic Rabbit(100350727) protocadherin beta 12
cow(100848799) protocadherin beta 12
domestic cat(101095465) protocadherin beta 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053137 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053137 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053137 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018932 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018932 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018932 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018932 Rosetta Predictions human pricing
NM_173099 Rosetta Predictions rat pricing
NM_053137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062725 predicted 639
2 SASI_Hs01_00062726 predicted 2626
3 SASI_Hs01_00062727 predicted 2610
4 SASI_Hs01_00062728 predicted 705
5 SASI_Hs01_00062729 predicted 1007
6 SASI_Hs01_00062730 predicted 486
7 SASI_Hs01_00062732 predicted 1314
8 SASI_Hs01_00062733 predicted 2427
9 SASI_Hs01_00062734 predicted 999
10 SASI_Hs02_00352390 predicted 1372
11 SASI_Hs01_00062731 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057882 predicted 2512
2 SASI_Rn01_00057883 predicted 2405
3 SASI_Rn02_00269249 predicted 1054
4 SASI_Rn01_00057885 predicted 882
5 SASI_Rn02_00269250 predicted 1063
6 SASI_Rn01_00057887 predicted 2395
7 SASI_Rn02_00269251 predicted 329
8 SASI_Rn01_00057890 predicted 1159
9 SASI_Rn02_00269252 predicted 2514
10 SASI_Rn02_00269253 predicted 2411
11 SASI_Rn01_00057881 predicted 1316
12 SASI_Rn01_00057884 predicted 973
13 SASI_Rn01_00057886 predicted 959
14 SASI_Rn01_00057888 predicted 907
15 SASI_Rn01_00057889 predicted 1982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337655 predicted 2537
2 SASI_Mm01_00069403 predicted 559
3 SASI_Mm02_00337656 predicted 2626
4 SASI_Mm01_00069405 predicted 1076
5 SASI_Mm02_00337657 predicted 2524
6 SASI_Mm01_00069406 predicted 1087
7 SASI_Mm01_00069407 predicted 2185
8 SASI_Mm01_00069411 predicted 2454
9 SASI_Mm01_00069408 predicted 1092
10 SASI_Mm02_00337658 predicted 2420
11 SASI_Mm01_00069402 predicted 1009
12 SASI_Mm01_00069404 predicted 868
13 SASI_Mm01_00069409 predicted 893
14 SASI_Mm01_00069410 predicted 910
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053137
PCDHB12 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 12
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053137.2-962s21c1
Sequence:CCGGGGACTTAGATGCTGGGATATACTCGAGTATATCCCAGCATCTAAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053137.2-2628s21c1
Sequence:CCGGGAGTCAACTCTTGAGATATATCTCGAGATATATCTCAAGAGTTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053137.1-880s1c1
Sequence:CCGGCGTCTGACCAAAGAGCTAGATCTCGAGATCTAGCTCTTTGGTCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053137.1-911s1c1
Sequence:CCGGGTCACCATTATACCATAGAAACTCGAGTTTCTATGGTATAATGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053137.1-1644s1c1
Sequence:CCGGCAATTCACCTTTCGTGCTCTACTCGAGTAGAGCACGAAAGGTGAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053137.1-56s1c1
Sequence:CCGGCTGACTCTGAGGCAATTAGATCTCGAGATCTAATTGCCTCAGAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053137.1-907s1c1
Sequence:CCGGGTAAGTCACCATTATACCATACTCGAGTATGGTATAATGGTGACTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053137
PCDHB12 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 12
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053137.2-962s21c1
Sequence:CCGGGGACTTAGATGCTGGGATATACTCGAGTATATCCCAGCATCTAAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053137.2-2628s21c1
Sequence:CCGGGAGTCAACTCTTGAGATATATCTCGAGATATATCTCAAGAGTTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053137.1-880s1c1
Sequence:CCGGCGTCTGACCAAAGAGCTAGATCTCGAGATCTAGCTCTTTGGTCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053137.1-911s1c1
Sequence:CCGGGTCACCATTATACCATAGAAACTCGAGTTTCTATGGTATAATGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053137.1-1644s1c1
Sequence:CCGGCAATTCACCTTTCGTGCTCTACTCGAGTAGAGCACGAAAGGTGAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053137.1-56s1c1
Sequence:CCGGCTGACTCTGAGGCAATTAGATCTCGAGATCTAATTGCCTCAGAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053137.1-907s1c1
Sequence:CCGGGTAAGTCACCATTATACCATACTCGAGTATGGTATAATGGTGACTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053137
PCDHB12 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 12
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053137.2-962s21c1
Sequence:CCGGGGACTTAGATGCTGGGATATACTCGAGTATATCCCAGCATCTAAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053137.2-2628s21c1
Sequence:CCGGGAGTCAACTCTTGAGATATATCTCGAGATATATCTCAAGAGTTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053137.1-880s1c1
Sequence:CCGGCGTCTGACCAAAGAGCTAGATCTCGAGATCTAGCTCTTTGGTCAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053137.1-911s1c1
Sequence:CCGGGTCACCATTATACCATAGAAACTCGAGTTTCTATGGTATAATGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053137.1-1644s1c1
Sequence:CCGGCAATTCACCTTTCGTGCTCTACTCGAGTAGAGCACGAAAGGTGAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053137.1-56s1c1
Sequence:CCGGCTGACTCTGAGGCAATTAGATCTCGAGATCTAATTGCCTCAGAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053137.1-907s1c1
Sequence:CCGGGTAAGTCACCATTATACCATACTCGAGTATGGTATAATGGTGACTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018932
PCDHB12 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018932.3-549s21c1
Sequence:CCGGGCTCCAGGTCAGGGATATAAACTCGAGTTTATATCCCTGACCTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018932.3-2639s21c1
Sequence:CCGGGGTGCCTGTAAAGTAGTATTTCTCGAGAAATACTACTTTACAGGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018932.3-2895s21c1
Sequence:CCGGTTAGAATGCTGTTCGAGTATACTCGAGTATACTCGAACAGCATTCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018932.2-2276s1c1
Sequence:CCGGCCAGGTCAAATAAGTTCAAATCTCGAGATTTGAACTTATTTGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018932.2-2336s1c1
Sequence:CCGGCAGGTAGTGAAGTCGAAGAAACTCGAGTTTCTTCGACTTCACTACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018932.2-1134s1c1
Sequence:CCGGCGGAAAGATGGTTTGTTCTATCTCGAGATAGAACAAACCATCTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018932.2-459s1c1
Sequence:CCGGGCTTGAAAGTGCAAAGGATTTCTCGAGAAATCCTTTGCACTTTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018932.2-520s1c1
Sequence:CCGGCCGAACTCTCATTTCCACGTTCTCGAGAACGTGGAAATGAGAGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018932
PCDHB12 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018932.3-549s21c1
Sequence:CCGGGCTCCAGGTCAGGGATATAAACTCGAGTTTATATCCCTGACCTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018932.3-2639s21c1
Sequence:CCGGGGTGCCTGTAAAGTAGTATTTCTCGAGAAATACTACTTTACAGGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018932.3-2895s21c1
Sequence:CCGGTTAGAATGCTGTTCGAGTATACTCGAGTATACTCGAACAGCATTCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018932.2-2276s1c1
Sequence:CCGGCCAGGTCAAATAAGTTCAAATCTCGAGATTTGAACTTATTTGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018932.2-2336s1c1
Sequence:CCGGCAGGTAGTGAAGTCGAAGAAACTCGAGTTTCTTCGACTTCACTACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018932.2-1134s1c1
Sequence:CCGGCGGAAAGATGGTTTGTTCTATCTCGAGATAGAACAAACCATCTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018932.2-459s1c1
Sequence:CCGGGCTTGAAAGTGCAAAGGATTTCTCGAGAAATCCTTTGCACTTTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018932.2-520s1c1
Sequence:CCGGCCGAACTCTCATTTCCACGTTCTCGAGAACGTGGAAATGAGAGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018932
PCDHB12 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018932.3-549s21c1
Sequence:CCGGGCTCCAGGTCAGGGATATAAACTCGAGTTTATATCCCTGACCTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018932.3-2639s21c1
Sequence:CCGGGGTGCCTGTAAAGTAGTATTTCTCGAGAAATACTACTTTACAGGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018932.3-2895s21c1
Sequence:CCGGTTAGAATGCTGTTCGAGTATACTCGAGTATACTCGAACAGCATTCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018932.2-2276s1c1
Sequence:CCGGCCAGGTCAAATAAGTTCAAATCTCGAGATTTGAACTTATTTGACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018932.2-2336s1c1
Sequence:CCGGCAGGTAGTGAAGTCGAAGAAACTCGAGTTTCTTCGACTTCACTACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018932.2-1134s1c1
Sequence:CCGGCGGAAAGATGGTTTGTTCTATCTCGAGATAGAACAAACCATCTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018932.2-459s1c1
Sequence:CCGGGCTTGAAAGTGCAAAGGATTTCTCGAGAAATCCTTTGCACTTTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018932.2-520s1c1
Sequence:CCGGCCGAACTCTCATTTCCACGTTCTCGAGAACGTGGAAATGAGAGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)