EMAIL THIS PAGE TO A FRIEND

PCDHB13

protocadherin beta 13

52 Gene Product Result for
Synonyms: PCDH-BETA13
UniProtKB ID: Q9Y5F0
Gene ID:
Human(56123) Summary: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Mouse(93884) protocadherin beta 13
Rat(307489) protocadherin beta 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053138 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053138 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053138 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018933 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018933 Rosetta Predictions human pricing
XM_001055698 Rosetta Predictions rat pricing
XM_001065031 Rosetta Predictions rat pricing
NM_053138 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017054 predicted 1414
2 SASI_Hs01_00017055 predicted 1473
3 SASI_Hs01_00017056 predicted 2667
4 SASI_Hs01_00017057 predicted 1076
5 SASI_Hs01_00017059 predicted 2626
6 SASI_Hs01_00017060 predicted 1392
7 SASI_Hs01_00017061 predicted 1039
8 SASI_Hs01_00017062 predicted 1467
9 SASI_Hs01_00017063 predicted 2622
10 SASI_Hs01_00017058 predicted 2568
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280678 predicted 1039
2 SASI_Rn02_00280679 predicted 485
3 SASI_Rn02_00280680 predicted 406
4 SASI_Rn02_00280681 predicted 732
5 SASI_Rn02_00280682 predicted 1166
6 SASI_Rn02_00280683 predicted 1218
7 SASI_Rn02_00280684 predicted 1161
8 SASI_Rn02_00280685 predicted 1181
9 SASI_Rn02_00280686 predicted 448
10 SASI_Rn02_00280687 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312620 predicted 1036
2 SASI_Rn02_00312621 predicted 406
3 SASI_Rn02_00312622 predicted 727
4 SASI_Rn02_00312623 predicted 1171
5 SASI_Rn02_00312624 predicted 1217
6 SASI_Rn02_00312625 predicted 1163
7 SASI_Rn02_00312626 predicted 1183
8 SASI_Rn02_00312627 predicted 449
9 SASI_Rn02_00312628 predicted 445
10 SASI_Rn02_00312629 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053138 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025827 predicted 490
2 SASI_Mm02_00337659 predicted 477
3 SASI_Mm01_00025830 predicted 1284
4 SASI_Mm02_00337660 predicted 265
5 SASI_Mm01_00025831 predicted 1222
6 SASI_Mm01_00025832 predicted 985
7 SASI_Mm01_00025833 predicted 1221
8 SASI_Mm01_00025834 predicted 1180
9 SASI_Mm01_00025835 predicted 1047
10 SASI_Mm01_00025836 predicted 1131
11 SASI_Mm01_00025828 predicted 407
12 SASI_Mm01_00025829 predicted 216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053138
PCDHB13 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 13
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000094055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053138.1-1075s1c1
Sequence:CCGGCCAGGTATCATAGTGGCAGTACTCGAGTACTGCCACTATGATACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053138.1-2055s1c1
Sequence:CCGGGCTCACGTTATACCTGGTTATCTCGAGATAACCAGGTATAACGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053138.1-400s1c1
Sequence:CCGGGCCAGAGAAATGCTCCTTAAACTCGAGTTTAAGGAGCATTTCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053138.1-352s1c1
Sequence:CCGGGCTGAACTGAGAGTTATAGATCTCGAGATCTATAACTCTCAGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053138
PCDHB13 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 13
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000094055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053138.1-1075s1c1
Sequence:CCGGCCAGGTATCATAGTGGCAGTACTCGAGTACTGCCACTATGATACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053138.1-2055s1c1
Sequence:CCGGGCTCACGTTATACCTGGTTATCTCGAGATAACCAGGTATAACGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053138.1-400s1c1
Sequence:CCGGGCCAGAGAAATGCTCCTTAAACTCGAGTTTAAGGAGCATTTCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053138.1-352s1c1
Sequence:CCGGGCTGAACTGAGAGTTATAGATCTCGAGATCTATAACTCTCAGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053138
PCDHB13 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 13
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000094055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053138.1-1075s1c1
Sequence:CCGGCCAGGTATCATAGTGGCAGTACTCGAGTACTGCCACTATGATACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053138.1-2055s1c1
Sequence:CCGGGCTCACGTTATACCTGGTTATCTCGAGATAACCAGGTATAACGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053138.1-400s1c1
Sequence:CCGGGCCAGAGAAATGCTCCTTAAACTCGAGTTTAAGGAGCATTTCTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053138.1-352s1c1
Sequence:CCGGGCTGAACTGAGAGTTATAGATCTCGAGATCTATAACTCTCAGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018933
PCDHB13 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 13
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018933.2-2555s1c1
Sequence:CCGGCCCAATAACTTTGGGTTCAATCTCGAGATTGAACCCAAAGTTATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018933.2-872s1c1
Sequence:CCGGGTCTACATCGAAGTCCTGGATCTCGAGATCCAGGACTTCGATGTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018933.2-1151s1c1
Sequence:CCGGGCAAGAGATGCTGGAACCTTTCTCGAGAAAGGTTCCAGCATCTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018933.2-550s1c1
Sequence:CCGGGCTGCAAGTAATAGACATAAACTCGAGTTTATGTCTATTACTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018933.2-1430s21c1
Sequence:CCGGGCGGAATACAACATCACTATCCTCGAGGATAGTGATGTTGTATTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018933.2-2820s21c1
Sequence:CCGGGAGCAATACCAAATCACATTTCTCGAGAAATGTGATTTGGTATTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018933.2-1072s1c1
Sequence:CCGGCAATCCCTTGACAGGAGAAATCTCGAGATTTCTCCTGTCAAGGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018933
PCDHB13 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 13
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018933.2-2555s1c1
Sequence:CCGGCCCAATAACTTTGGGTTCAATCTCGAGATTGAACCCAAAGTTATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018933.2-872s1c1
Sequence:CCGGGTCTACATCGAAGTCCTGGATCTCGAGATCCAGGACTTCGATGTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018933.2-1151s1c1
Sequence:CCGGGCAAGAGATGCTGGAACCTTTCTCGAGAAAGGTTCCAGCATCTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018933.2-550s1c1
Sequence:CCGGGCTGCAAGTAATAGACATAAACTCGAGTTTATGTCTATTACTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018933.2-1430s21c1
Sequence:CCGGGCGGAATACAACATCACTATCCTCGAGGATAGTGATGTTGTATTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018933.2-2820s21c1
Sequence:CCGGGAGCAATACCAAATCACATTTCTCGAGAAATGTGATTTGGTATTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018933.2-1072s1c1
Sequence:CCGGCAATCCCTTGACAGGAGAAATCTCGAGATTTCTCCTGTCAAGGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018933
PCDHB13 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 13
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018933.2-2555s1c1
Sequence:CCGGCCCAATAACTTTGGGTTCAATCTCGAGATTGAACCCAAAGTTATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018933.2-872s1c1
Sequence:CCGGGTCTACATCGAAGTCCTGGATCTCGAGATCCAGGACTTCGATGTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018933.2-1151s1c1
Sequence:CCGGGCAAGAGATGCTGGAACCTTTCTCGAGAAAGGTTCCAGCATCTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018933.2-550s1c1
Sequence:CCGGGCTGCAAGTAATAGACATAAACTCGAGTTTATGTCTATTACTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018933.2-1430s21c1
Sequence:CCGGGCGGAATACAACATCACTATCCTCGAGGATAGTGATGTTGTATTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018933.2-2820s21c1
Sequence:CCGGGAGCAATACCAAATCACATTTCTCGAGAAATGTGATTTGGTATTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018933.2-1072s1c1
Sequence:CCGGCAATCCCTTGACAGGAGAAATCTCGAGATTTCTCCTGTCAAGGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)