EMAIL THIS PAGE TO A FRIEND

PCDHB14

protocadherin beta 14

49 Gene Product Result for
Synonyms: PCDH-BETA14
UniProtKB ID: Q9Y5E9, Q4FZA4, Q4KN11
Gene ID:
Human(56122) Summary: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Mouse(93885) protocadherin beta 14
Rat(291647) protocadherin beta 14
Domestic Rabbit(100353156) protocadherin beta 14
naked mole-rat(101696900) protocadherin beta 14
cow(615130) protocadherin beta 14
sheep(101102310) protocadherin beta 14
dog(487175) protocadherin beta 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053139 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053139 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053139 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018934 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018934 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018934 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018934 Rosetta Predictions human pricing
XM_001055753 Rosetta Predictions rat pricing
XM_001065084 Rosetta Predictions rat pricing
NM_053139 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162089 predicted 2351
2 SASI_Hs01_00162090 predicted 580
3 SASI_Hs01_00162091 predicted 2376
4 SASI_Hs01_00162092 predicted 1030
5 SASI_Hs02_00352391 predicted 2460
6 SASI_Hs01_00162093 predicted 226
7 SASI_Hs01_00162095 predicted 351
8 SASI_Hs01_00162097 predicted 669
9 SASI_Hs02_00352392 predicted 2490
10 SASI_Hs01_00162098 predicted 991
11 SASI_Hs01_00162094 predicted 547
12 SASI_Hs01_00162096 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280879 predicted 505
2 SASI_Rn02_00280880 predicted 849
3 SASI_Rn02_00280881 predicted 228
4 SASI_Rn02_00280882 predicted 1121
5 SASI_Rn02_00280883 predicted 1217
6 SASI_Rn02_00280884 predicted 674
7 SASI_Rn02_00280885 predicted 1224
8 SASI_Rn02_00280886 predicted 1749
9 SASI_Rn02_00280887 predicted 681
10 SASI_Rn02_00280888 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312792 predicted 506
2 SASI_Rn02_00312793 predicted 856
3 SASI_Rn02_00312794 predicted 228
4 SASI_Rn02_00312795 predicted 1115
5 SASI_Rn02_00312796 predicted 1215
6 SASI_Rn02_00312797 predicted 681
7 SASI_Rn02_00312798 predicted 1233
8 SASI_Rn02_00312799 predicted 1748
9 SASI_Rn02_00312800 predicted 678
10 SASI_Rn02_00312801 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034386 predicted 485
2 SASI_Mm01_00034387 predicted 2505
3 SASI_Mm01_00034388 predicted 1115
4 SASI_Mm01_00034389 predicted 471
5 SASI_Mm01_00034391 predicted 457
6 SASI_Mm01_00034392 predicted 2460
7 SASI_Mm01_00034393 predicted 1435
8 SASI_Mm01_00034394 predicted 794
9 SASI_Mm01_00034395 predicted 224
10 SASI_Mm02_00337661 predicted 1230
11 SASI_Mm01_00034390 predicted 1083
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053139
PCDHB14 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 14
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053139.2-1270s1c1
Sequence:CCGGCCTGAAACTATAGTCGCGATTCTCGAGAATCGCGACTATAGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053139.2-485s1c1
Sequence:CCGGCCAATCCGTGTATCCTACATTCTCGAGAATGTAGGATACACGGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053139.2-973s1c1
Sequence:CCGGCTCACTGTATCCGCAAGAGATCTCGAGATCTCTTGCGGATACAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053139.3-266s21c1
Sequence:CCGGGTAGTGCAACCATCACGTATTCTCGAGAATACGTGATGGTTGCACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053139.2-1082s1c1
Sequence:CCGGCCGGAGAAATTAGAGTAAGAACTCGAGTTCTTACTCTAATTTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053139.2-2932s1c1
Sequence:CCGGGCTATTGTAAATGATGGCTTTCTCGAGAAAGCCATCATTTACAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053139.3-2667s21c1
Sequence:CCGGCATGATACTGGTAGTCATATTCTCGAGAATATGACTACCAGTATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053139.3-220s21c1
Sequence:CCGGAGGCAAGTGACCGCCATTATCCTCGAGGATAATGGCGGTCACTTGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053139.3-1234s21c1
Sequence:CCGGTCAGTACTTATCAGCGAAATTCTCGAGAATTTCGCTGATAAGTACTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053139
PCDHB14 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 14
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053139.2-1270s1c1
Sequence:CCGGCCTGAAACTATAGTCGCGATTCTCGAGAATCGCGACTATAGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053139.2-485s1c1
Sequence:CCGGCCAATCCGTGTATCCTACATTCTCGAGAATGTAGGATACACGGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053139.2-973s1c1
Sequence:CCGGCTCACTGTATCCGCAAGAGATCTCGAGATCTCTTGCGGATACAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053139.3-266s21c1
Sequence:CCGGGTAGTGCAACCATCACGTATTCTCGAGAATACGTGATGGTTGCACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053139.2-1082s1c1
Sequence:CCGGCCGGAGAAATTAGAGTAAGAACTCGAGTTCTTACTCTAATTTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053139.2-2932s1c1
Sequence:CCGGGCTATTGTAAATGATGGCTTTCTCGAGAAAGCCATCATTTACAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053139.3-2667s21c1
Sequence:CCGGCATGATACTGGTAGTCATATTCTCGAGAATATGACTACCAGTATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053139.3-220s21c1
Sequence:CCGGAGGCAAGTGACCGCCATTATCCTCGAGGATAATGGCGGTCACTTGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053139.3-1234s21c1
Sequence:CCGGTCAGTACTTATCAGCGAAATTCTCGAGAATTTCGCTGATAAGTACTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053139
PCDHB14 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 14
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053139.2-1270s1c1
Sequence:CCGGCCTGAAACTATAGTCGCGATTCTCGAGAATCGCGACTATAGTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053139.2-485s1c1
Sequence:CCGGCCAATCCGTGTATCCTACATTCTCGAGAATGTAGGATACACGGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053139.2-973s1c1
Sequence:CCGGCTCACTGTATCCGCAAGAGATCTCGAGATCTCTTGCGGATACAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053139.3-266s21c1
Sequence:CCGGGTAGTGCAACCATCACGTATTCTCGAGAATACGTGATGGTTGCACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053139.2-1082s1c1
Sequence:CCGGCCGGAGAAATTAGAGTAAGAACTCGAGTTCTTACTCTAATTTCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053139.2-2932s1c1
Sequence:CCGGGCTATTGTAAATGATGGCTTTCTCGAGAAAGCCATCATTTACAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053139.3-2667s21c1
Sequence:CCGGCATGATACTGGTAGTCATATTCTCGAGAATATGACTACCAGTATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053139.3-220s21c1
Sequence:CCGGAGGCAAGTGACCGCCATTATCCTCGAGGATAATGGCGGTCACTTGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053139.3-1234s21c1
Sequence:CCGGTCAGTACTTATCAGCGAAATTCTCGAGAATTTCGCTGATAAGTACTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018934
PCDHB14 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 14
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018934.2-850s1c1
Sequence:CCGGGCATCAGAAGATATTCGTAAACTCGAGTTTACGAATATCTTCTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018934.2-595s1c1
Sequence:CCGGGCTTTAGATTATGAACAGGAACTCGAGTTCCTGTTCATAATCTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018934.2-520s1c1
Sequence:CCGGCCCAATTCTCACTTCTACATTCTCGAGAATGTAGAAGTGAGAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018934.2-2375s1c1
Sequence:CCGGGCTTTGGACTTAACATTCAATCTCGAGATTGAATGTTAAGTCCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018934.2-992s1c1
Sequence:CCGGGCACCCTTCTAGTTAAAGTTACTCGAGTAACTTTAACTAGAAGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018934.2-2488s21c1
Sequence:CCGGGTAGTTGCATGCATGATTATACTCGAGTATAATCATGCATGCAACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018934.2-931s21c1
Sequence:CCGGGTAATACAGTCCTACACTATACTCGAGTATAGTGTAGGACTGTATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018934
PCDHB14 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 14
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018934.2-850s1c1
Sequence:CCGGGCATCAGAAGATATTCGTAAACTCGAGTTTACGAATATCTTCTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018934.2-595s1c1
Sequence:CCGGGCTTTAGATTATGAACAGGAACTCGAGTTCCTGTTCATAATCTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018934.2-520s1c1
Sequence:CCGGCCCAATTCTCACTTCTACATTCTCGAGAATGTAGAAGTGAGAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018934.2-2375s1c1
Sequence:CCGGGCTTTGGACTTAACATTCAATCTCGAGATTGAATGTTAAGTCCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018934.2-992s1c1
Sequence:CCGGGCACCCTTCTAGTTAAAGTTACTCGAGTAACTTTAACTAGAAGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018934.2-2488s21c1
Sequence:CCGGGTAGTTGCATGCATGATTATACTCGAGTATAATCATGCATGCAACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018934.2-931s21c1
Sequence:CCGGGTAATACAGTCCTACACTATACTCGAGTATAGTGTAGGACTGTATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018934
PCDHB14 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 14
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018934.2-850s1c1
Sequence:CCGGGCATCAGAAGATATTCGTAAACTCGAGTTTACGAATATCTTCTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018934.2-595s1c1
Sequence:CCGGGCTTTAGATTATGAACAGGAACTCGAGTTCCTGTTCATAATCTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018934.2-520s1c1
Sequence:CCGGCCCAATTCTCACTTCTACATTCTCGAGAATGTAGAAGTGAGAATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018934.2-2375s1c1
Sequence:CCGGGCTTTGGACTTAACATTCAATCTCGAGATTGAATGTTAAGTCCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018934.2-992s1c1
Sequence:CCGGGCACCCTTCTAGTTAAAGTTACTCGAGTAACTTTAACTAGAAGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018934.2-2488s21c1
Sequence:CCGGGTAGTTGCATGCATGATTATACTCGAGTATAATCATGCATGCAACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018934.2-931s21c1
Sequence:CCGGGTAATACAGTCCTACACTATACTCGAGTATAGTGTAGGACTGTATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)