EMAIL THIS PAGE TO A FRIEND

PCDHB15

protocadherin beta 15

52 Gene Product Result for
Synonyms: PCDH-BETA15
UniProtKB ID: Q9Y5E8, Q8IUX5
Gene ID:
Human(56121) Summary: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Mouse(93886) protocadherin beta 15
Rat(291646) protocadherin beta 15
chicken(430496) protocadherin beta 15
Horse(100072292) protocadherin beta 15
dog(487178) protocadherin beta 15
cow(787005) protocadherin beta 15
sheep(101103720) protocadherin beta 15
naked mole-rat(101697644) protocadherin beta 15
Domestic Rabbit(100353409) protocadherin beta 15
domestic guinea pig(100725149) protocadherin beta 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018935 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018935 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018935 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053140 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053140 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053140 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018935 Rosetta Predictions human pricing
XM_001055818 Rosetta Predictions rat pricing
XM_001065137 Rosetta Predictions rat pricing
NM_053140 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228855 predicted 932
2 SASI_Hs01_00228856 predicted 923
3 SASI_Hs01_00228857 predicted 887
4 SASI_Hs01_00228858 predicted 818
5 SASI_Hs01_00228859 predicted 350
6 SASI_Hs01_00228860 predicted 940
7 SASI_Hs01_00228862 predicted 1016
8 SASI_Hs01_00228863 predicted 797
9 SASI_Hs01_00228864 predicted 502
10 SASI_Hs02_00352393 predicted 812
11 SASI_Hs01_00228861 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055818 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281125 predicted 1718
2 SASI_Rn02_00281126 predicted 987
3 SASI_Rn02_00281127 predicted 1063
4 SASI_Rn02_00281128 predicted 1109
5 SASI_Rn02_00281129 predicted 666
6 SASI_Rn02_00281130 predicted 1162
7 SASI_Rn02_00281131 predicted 1294
8 SASI_Rn02_00281132 predicted 794
9 SASI_Rn02_00281133 predicted 370
10 SASI_Rn02_00281134 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313022 predicted 1722
2 SASI_Rn02_00313023 predicted 986
3 SASI_Rn02_00313024 predicted 1064
4 SASI_Rn02_00313025 predicted 1109
5 SASI_Rn02_00313026 predicted 669
6 SASI_Rn02_00313027 predicted 1163
7 SASI_Rn02_00313028 predicted 1289
8 SASI_Rn02_00313029 predicted 792
9 SASI_Rn02_00313030 predicted 372
10 SASI_Rn02_00313031 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197814 predicted 1099
2 SASI_Mm01_00197815 predicted 203
3 SASI_Mm02_00337662 predicted 413
4 SASI_Mm01_00197816 predicted 778
5 SASI_Mm02_00337663 predicted 1390
6 SASI_Mm01_00197817 predicted 1048
7 SASI_Mm01_00197818 predicted 2565
8 SASI_Mm01_00197819 predicted 1397
9 SASI_Mm01_00197820 predicted 291
10 SASI_Mm01_00197821 predicted 1150
11 SASI_Mm01_00197822 predicted 791
12 SASI_Mm01_00197823 predicted 2539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018935
PCDHB15 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 15
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-368s1c2
Sequence:CCGGTGACAGACATAAACGATCATTCTCGAGAATGATCGTTTATGTCTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-1011s1c1
Sequence:CCGGGCTGGATGTTAACGATAACTTCTCGAGAAGTTATCGTTAACATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-2301s1c1
Sequence:CCGGGAAGCCTATATTCCCAAATATCTCGAGATATTTGGGAATATAGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-854s1c1
Sequence:CCGGCTCAGGAGATAGACAAACCTTCTCGAGAAGGTTTGTCTATCTCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-391s1c1
Sequence:CCGGCCTGAGTTTCCTGAAAGAGAACTCGAGTTCTCTTTCAGGAAACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-368s1c1
Sequence:CCGGTGACAGACATAAACGATCATTCTCGAGAATGATCGTTTATGTCTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018935
PCDHB15 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 15
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-368s1c2
Sequence:CCGGTGACAGACATAAACGATCATTCTCGAGAATGATCGTTTATGTCTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-1011s1c1
Sequence:CCGGGCTGGATGTTAACGATAACTTCTCGAGAAGTTATCGTTAACATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-2301s1c1
Sequence:CCGGGAAGCCTATATTCCCAAATATCTCGAGATATTTGGGAATATAGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-854s1c1
Sequence:CCGGCTCAGGAGATAGACAAACCTTCTCGAGAAGGTTTGTCTATCTCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-391s1c1
Sequence:CCGGCCTGAGTTTCCTGAAAGAGAACTCGAGTTCTCTTTCAGGAAACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-368s1c1
Sequence:CCGGTGACAGACATAAACGATCATTCTCGAGAATGATCGTTTATGTCTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018935
PCDHB15 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 15
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-368s1c2
Sequence:CCGGTGACAGACATAAACGATCATTCTCGAGAATGATCGTTTATGTCTGTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-1011s1c1
Sequence:CCGGGCTGGATGTTAACGATAACTTCTCGAGAAGTTATCGTTAACATCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-2301s1c1
Sequence:CCGGGAAGCCTATATTCCCAAATATCTCGAGATATTTGGGAATATAGGCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-854s1c1
Sequence:CCGGCTCAGGAGATAGACAAACCTTCTCGAGAAGGTTTGTCTATCTCCTGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-391s1c1
Sequence:CCGGCCTGAGTTTCCTGAAAGAGAACTCGAGTTCTCTTTCAGGAAACTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018935.2-368s1c1
Sequence:CCGGTGACAGACATAAACGATCATTCTCGAGAATGATCGTTTATGTCTGTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053140
PCDHB15 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053140.2-2582s1c1
Sequence:CCGGCCTTGTTGTGTAATGAAGAATCTCGAGATTCTTCATTACACAACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053140.2-1394s1c1
Sequence:CCGGGCCTTTAGATAGAGAATCAAACTCGAGTTTGATTCTCTATCTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053140.2-2490s1c1
Sequence:CCGGGCCTCTAACTTCCTAACCGAACTCGAGTTCGGTTAGGAAGTTAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053140.2-1104s1c1
Sequence:CCGGGCGATTCAAACTTATTCGATACTCGAGTATCGAATAAGTTTGAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053140.2-528s1c1
Sequence:CCGGGCTGCACTACATATCAAAGATCTCGAGATCTTTGATATGTAGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053140
PCDHB15 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053140.2-2582s1c1
Sequence:CCGGCCTTGTTGTGTAATGAAGAATCTCGAGATTCTTCATTACACAACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053140.2-1394s1c1
Sequence:CCGGGCCTTTAGATAGAGAATCAAACTCGAGTTTGATTCTCTATCTAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053140.2-2490s1c1
Sequence:CCGGGCCTCTAACTTCCTAACCGAACTCGAGTTCGGTTAGGAAGTTAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053140.2-1104s1c1
Sequence:CCGGGCGATTCAAACTTATTCGATACTCGAGTATCGAATAAGTTTGAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053140.2-528s1c1
Sequence:CCGGGCTGCACTACATATCAAAGATCTCGAGATCTTTGATATGTAGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053140
PCDHB15 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053140.2-2582s1c1
Sequence:CCGGCCTTGTTGTGTAATGAAGAATCTCGAGATTCTTCATTACACAACAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053140.2-1394s1c1
Sequence:CCGGGCCTTTAGATAGAGAATCAAACTCGAGTTTGATTCTCTATCTAAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053140.2-2490s1c1
Sequence:CCGGGCCTCTAACTTCCTAACCGAACTCGAGTTCGGTTAGGAAGTTAGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053140.2-1104s1c1
Sequence:CCGGGCGATTCAAACTTATTCGATACTCGAGTATCGAATAAGTTTGAATCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053140.2-528s1c1
Sequence:CCGGGCTGCACTACATATCAAAGATCTCGAGATCTTTGATATGTAGTGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)