EMAIL THIS PAGE TO A FRIEND

PCDHB1

protocadherin beta 1

47 Gene Product Result for
Synonyms: PCDH-BETA1
UniProtKB ID: Q9Y5F3, Q2M257
Gene ID:
Human(29930) Summary: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Mouse(93872) protocadherin beta 1
Rat(364841) protocadherin beta 1
dog(487168) protocadherin beta 1
domestic cat(101099426) protocadherin beta 1
cow(504206) protocadherin beta 1
sheep(101123628) protocadherin beta 1
domestic guinea pig(100717684) protocadherin beta 1
naked mole-rat(101705308) protocadherin beta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053126 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053126 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053126 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013340 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013340 Rosetta Predictions human pricing
XM_001054930 Rosetta Predictions rat pricing
XM_001064318 Rosetta Predictions rat pricing
NM_053126 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228094 predicted 319
2 SASI_Hs01_00228095 predicted 1022
3 SASI_Hs01_00228096 predicted 1380
4 SASI_Hs01_00228097 predicted 2190
5 SASI_Hs01_00228098 predicted 1736
6 SASI_Hs01_00228100 predicted 198
7 SASI_Hs01_00228101 predicted 1392
8 SASI_Hs01_00228102 predicted 1231
9 SASI_Hs01_00228103 predicted 2129
10 SASI_Hs02_00344652 predicted 2295
11 SASI_Hs01_00228099 predicted 1989
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054930 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277767 predicted 1470
2 SASI_Rn02_00277768 predicted 1285
3 SASI_Rn02_00277769 predicted 1847
4 SASI_Rn02_00277770 predicted 1279
5 SASI_Rn02_00277771 predicted 2421
6 SASI_Rn02_00277772 predicted 1769
7 SASI_Rn02_00277773 predicted 869
8 SASI_Rn02_00277774 predicted 1554
9 SASI_Rn02_00277775 predicted 2049
10 SASI_Rn02_00277776 predicted 1759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064318 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310028 predicted 1470
2 SASI_Rn02_00310029 predicted 1293
3 SASI_Rn02_00310030 predicted 1852
4 SASI_Rn02_00310031 predicted 1274
5 SASI_Rn02_00310032 predicted 2421
6 SASI_Rn02_00310033 predicted 1765
7 SASI_Rn02_00310034 predicted 873
8 SASI_Rn02_00310035 predicted 1557
9 SASI_Rn02_00310036 predicted 2050
10 SASI_Rn02_00310037 predicted 1756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143158 predicted 1569
2 SASI_Mm01_00143159 predicted 1037
3 SASI_Mm01_00143160 predicted 277
4 SASI_Mm01_00143161 predicted 1537
5 SASI_Mm01_00143162 predicted 1017
6 SASI_Mm01_00143163 predicted 2164
7 SASI_Mm01_00143164 predicted 1569
8 SASI_Mm02_00337641 predicted 355
9 SASI_Mm01_00143166 predicted 1249
10 SASI_Mm01_00143167 predicted 1525
11 SASI_Mm01_00143165 predicted 1746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053126
PCDHB1 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053126.1-513s1c1
Sequence:CCGGCCTGAGTGCAAACACCTATTTCTCGAGAAATAGGTGTTTGCACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053126.1-859s1c1
Sequence:CCGGGCAGTTCTACGGACATTTCTTCTCGAGAAGAAATGTCCGTAGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053126.1-2196s1c1
Sequence:CCGGTGACTGTAATTTCCCTAACAACTCGAGTTGTTAGGGAAATTACAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053126.1-1794s1c1
Sequence:CCGGGCAGAATTCTTGGCTTTCATACTCGAGTATGAAAGCCAAGAATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053126.1-204s1c1
Sequence:CCGGCGAGGGTAACAGGTTGCATTTCTCGAGAAATGCAACCTGTTACCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053126
PCDHB1 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053126.1-513s1c1
Sequence:CCGGCCTGAGTGCAAACACCTATTTCTCGAGAAATAGGTGTTTGCACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053126.1-859s1c1
Sequence:CCGGGCAGTTCTACGGACATTTCTTCTCGAGAAGAAATGTCCGTAGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053126.1-2196s1c1
Sequence:CCGGTGACTGTAATTTCCCTAACAACTCGAGTTGTTAGGGAAATTACAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053126.1-1794s1c1
Sequence:CCGGGCAGAATTCTTGGCTTTCATACTCGAGTATGAAAGCCAAGAATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053126.1-204s1c1
Sequence:CCGGCGAGGGTAACAGGTTGCATTTCTCGAGAAATGCAACCTGTTACCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053126
PCDHB1 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053126.1-513s1c1
Sequence:CCGGCCTGAGTGCAAACACCTATTTCTCGAGAAATAGGTGTTTGCACTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053126.1-859s1c1
Sequence:CCGGGCAGTTCTACGGACATTTCTTCTCGAGAAGAAATGTCCGTAGAACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053126.1-2196s1c1
Sequence:CCGGTGACTGTAATTTCCCTAACAACTCGAGTTGTTAGGGAAATTACAGTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053126.1-1794s1c1
Sequence:CCGGGCAGAATTCTTGGCTTTCATACTCGAGTATGAAAGCCAAGAATTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053126.1-204s1c1
Sequence:CCGGCGAGGGTAACAGGTTGCATTTCTCGAGAAATGCAACCTGTTACCCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013340
PCDHB1 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013340.2-1905s1c1
Sequence:CCGGGCCACTGACCTTGGGTTATTTCTCGAGAAATAACCCAAGGTCAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013340.2-378s1c1
Sequence:CCGGCCTTGTGTTCTGCACTTTGAACTCGAGTTCAAAGTGCAGAACACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013340.2-949s1c1
Sequence:CCGGCGTTTCAGATTGACCCTCAAACTCGAGTTTGAGGGTCAATCTGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013340.2-1008s1c1
Sequence:CCGGGCCATTGAAACATACGACATTCTCGAGAATGTCGTATGTTTCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013340.2-2122s1c1
Sequence:CCGGGAAAGGTAAATCCATCCACTACTCGAGTAGTGGATGGATTTACCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013340.2-1315s21c1
Sequence:CCGGAGGAGGTCTCAGGCTATAATACTCGAGTATTATAGCCTGAGACCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013340.2-157s21c1
Sequence:CCGGATGCGACAACTATCCGCTATTCTCGAGAATAGCGGATAGTTGTCGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013340.2-1384s21c1
Sequence:CCGGCTATGATAGAGGTGCTAATATCTCGAGATATTAGCACCTCTATCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013340
PCDHB1 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013340.2-1905s1c1
Sequence:CCGGGCCACTGACCTTGGGTTATTTCTCGAGAAATAACCCAAGGTCAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013340.2-378s1c1
Sequence:CCGGCCTTGTGTTCTGCACTTTGAACTCGAGTTCAAAGTGCAGAACACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013340.2-949s1c1
Sequence:CCGGCGTTTCAGATTGACCCTCAAACTCGAGTTTGAGGGTCAATCTGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013340.2-1008s1c1
Sequence:CCGGGCCATTGAAACATACGACATTCTCGAGAATGTCGTATGTTTCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013340.2-2122s1c1
Sequence:CCGGGAAAGGTAAATCCATCCACTACTCGAGTAGTGGATGGATTTACCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013340.2-1315s21c1
Sequence:CCGGAGGAGGTCTCAGGCTATAATACTCGAGTATTATAGCCTGAGACCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013340.2-157s21c1
Sequence:CCGGATGCGACAACTATCCGCTATTCTCGAGAATAGCGGATAGTTGTCGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013340.2-1384s21c1
Sequence:CCGGCTATGATAGAGGTGCTAATATCTCGAGATATTAGCACCTCTATCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013340
PCDHB1 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013340.2-1905s1c1
Sequence:CCGGGCCACTGACCTTGGGTTATTTCTCGAGAAATAACCCAAGGTCAGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013340.2-378s1c1
Sequence:CCGGCCTTGTGTTCTGCACTTTGAACTCGAGTTCAAAGTGCAGAACACAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013340.2-949s1c1
Sequence:CCGGCGTTTCAGATTGACCCTCAAACTCGAGTTTGAGGGTCAATCTGAAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013340.2-1008s1c1
Sequence:CCGGGCCATTGAAACATACGACATTCTCGAGAATGTCGTATGTTTCAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013340.2-2122s1c1
Sequence:CCGGGAAAGGTAAATCCATCCACTACTCGAGTAGTGGATGGATTTACCTTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013340.2-1315s21c1
Sequence:CCGGAGGAGGTCTCAGGCTATAATACTCGAGTATTATAGCCTGAGACCTCCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013340.2-157s21c1
Sequence:CCGGATGCGACAACTATCCGCTATTCTCGAGAATAGCGGATAGTTGTCGCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013340.2-1384s21c1
Sequence:CCGGCTATGATAGAGGTGCTAATATCTCGAGATATTAGCACCTCTATCATAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)