EMAIL THIS PAGE TO A FRIEND

PCDHB2

protocadherin beta 2

41 Gene Product Result for
Synonyms: PCDH-BETA2
UniProtKB ID: Q9Y5E7, Q4KMU1
Gene ID:
Human(56133) Summary: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Mouse(93873) protocadherin beta 2
Rat(498843) protocadherin beta 2
dog(487169) protocadherin beta 2
domestic cat(101093742) protocadherin beta 2
domestic guinea pig(100718247) protocadherin beta 2
Domestic Rabbit(100352907) protocadherin beta 2
naked mole-rat(101696531) protocadherin beta 2
cow(616427) protocadherin beta 2
sheep(101122600) protocadherin beta 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053127 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053127 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053127 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018936 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU022821 MISSION® esiRNA esiRNA targeting mouse Pcdhb2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018936 Rosetta Predictions human pricing
NM_001109123 Rosetta Predictions rat pricing
NM_053127 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091415 predicted 1163
2 SASI_Hs01_00091416 predicted 987
3 SASI_Hs01_00091417 predicted 1122
4 SASI_Hs01_00091418 predicted 657
5 SASI_Hs01_00091419 predicted 965
6 SASI_Hs01_00091420 predicted 1125
7 SASI_Hs01_00091422 predicted 675
8 SASI_Hs01_00091421 predicted 1076
9 SASI_Hs01_00091423 predicted 1276
10 SASI_Hs01_00091424 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109123 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245350 predicted 426
2 SASI_Rn02_00245351 predicted 1359
3 SASI_Rn02_00245352 predicted 819
4 SASI_Rn02_00245353 predicted 820
5 SASI_Rn02_00245354 predicted 327
6 SASI_Rn02_00245355 predicted 326
7 SASI_Rn02_00245356 predicted 618
8 SASI_Rn02_00245357 predicted 618
9 SASI_Rn02_00245358 predicted 360
10 SASI_Rn02_00245359 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337642 predicted 2499
2 SASI_Mm01_00191620 predicted 2183
3 SASI_Mm01_00191621 predicted 963
4 SASI_Mm01_00191622 predicted 497
5 SASI_Mm02_00337643 predicted 872
6 SASI_Mm01_00191623 predicted 754
7 SASI_Mm01_00191625 predicted 457
8 SASI_Mm02_00337644 predicted 766
9 SASI_Mm02_00337645 predicted 2313
10 SASI_Mm01_00191627 predicted 1227
11 SASI_Mm01_00191624 predicted 1104
12 SASI_Mm01_00191626 predicted 331
13 SASI_Mm01_00191628 predicted 827
14 SASI_Mm01_00191629 predicted 1103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053127
PCDHB2 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053127.1-856s1c1
Sequence:CCGGGCCTCTGAAGACATTCGGAAACTCGAGTTTCCGAATGTCTTCAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053127.1-2048s1c1
Sequence:CCGGCCCAAGATGAGGACATACTAACTCGAGTTAGTATGTCCTCATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053127.1-618s1c1
Sequence:CCGGGCGATCAGAAATCAGATTAATCTCGAGATTAATCTGATTTCTGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053127.2-1069s21c1
Sequence:CCGGTGAATCCATCCAGGCATATACCTCGAGGTATATGCCTGGATGGATTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053127.1-366s1c1
Sequence:CCGGGCTACAGATTAGGGACATAAACTCGAGTTTATGTCCCTAATCTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053127.1-198s1c1
Sequence:CCGGGCGAGTCATTTCCAAAGGGAACTCGAGTTCCCTTTGGAAATGACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053127
PCDHB2 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053127.1-856s1c1
Sequence:CCGGGCCTCTGAAGACATTCGGAAACTCGAGTTTCCGAATGTCTTCAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053127.1-2048s1c1
Sequence:CCGGCCCAAGATGAGGACATACTAACTCGAGTTAGTATGTCCTCATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053127.1-618s1c1
Sequence:CCGGGCGATCAGAAATCAGATTAATCTCGAGATTAATCTGATTTCTGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053127.2-1069s21c1
Sequence:CCGGTGAATCCATCCAGGCATATACCTCGAGGTATATGCCTGGATGGATTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053127.1-366s1c1
Sequence:CCGGGCTACAGATTAGGGACATAAACTCGAGTTTATGTCCCTAATCTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053127.1-198s1c1
Sequence:CCGGGCGAGTCATTTCCAAAGGGAACTCGAGTTCCCTTTGGAAATGACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053127
PCDHB2 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053127.1-856s1c1
Sequence:CCGGGCCTCTGAAGACATTCGGAAACTCGAGTTTCCGAATGTCTTCAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053127.1-2048s1c1
Sequence:CCGGCCCAAGATGAGGACATACTAACTCGAGTTAGTATGTCCTCATCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053127.1-618s1c1
Sequence:CCGGGCGATCAGAAATCAGATTAATCTCGAGATTAATCTGATTTCTGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053127.2-1069s21c1
Sequence:CCGGTGAATCCATCCAGGCATATACCTCGAGGTATATGCCTGGATGGATTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053127.1-366s1c1
Sequence:CCGGGCTACAGATTAGGGACATAAACTCGAGTTTATGTCCCTAATCTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053127.1-198s1c1
Sequence:CCGGGCGAGTCATTTCCAAAGGGAACTCGAGTTCCCTTTGGAAATGACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018936
VALIDATED
PCDHB2 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018936.2-174s21c1
Sequence:CCGGACAAAGGCAAGTCCTGATATTCTCGAGAATATCAGGACTTGCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018936.2-1080s1c1
Sequence:CCGGCCAGACATACACAGTAAATATCTCGAGATATTTACTGTGTATGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018936.2-941s1c1
Sequence:CCGGCCAGGGATTTAGACATTGGAACTCGAGTTCCAATGTCTAAATCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018936.2-504s1c1
Sequence:CCGGGCTACGGATTAGGGACGTAAACTCGAGTTTACGTCCCTAATCCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018936.2-1295s1c1
Sequence:CCGGCCATCCAAGATGATCTTCCTTCTCGAGAAGGAAGATCATCTTGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018936.2-336s1c1
Sequence:CCGGCAGGGTCGTTTCCAAAGGAAACTCGAGTTTCCTTTGGAAACGACCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-267s21c1
Sequence:CCGGTGGCTCCTTTGTGGCCAATTTCTCGAGAAATTGGCCACAAAGGAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-652s21c1
Sequence:CCGGTACACAATCAGTCCCAATTTCCTCGAGGAAATTGGGACTGATTGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-1079s21c1
Sequence:CCGGTCCAGACATACACAGTAAATACTCGAGTATTTACTGTGTATGTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-2554s21c1
Sequence:CCGGTGAGGCTAGTCTCGTTTAATTCTCGAGAATTAAACGAGACTAGCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-505s21c1
Sequence:CCGGCTACGGATTAGGGACGTAAATCTCGAGATTTACGTCCCTAATCCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-1182s21c1
Sequence:CCGGACTAACTATGTCGACACTTATCTCGAGATAAGTGTCGACATAGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-694s21c1
Sequence:CCGGGACAGTCTCGATGGCATAATACTCGAGTATTATGCCATCGAGACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018936
VALIDATED
PCDHB2 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018936.2-174s21c1
Sequence:CCGGACAAAGGCAAGTCCTGATATTCTCGAGAATATCAGGACTTGCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018936.2-1080s1c1
Sequence:CCGGCCAGACATACACAGTAAATATCTCGAGATATTTACTGTGTATGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018936.2-941s1c1
Sequence:CCGGCCAGGGATTTAGACATTGGAACTCGAGTTCCAATGTCTAAATCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018936.2-504s1c1
Sequence:CCGGGCTACGGATTAGGGACGTAAACTCGAGTTTACGTCCCTAATCCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018936.2-1295s1c1
Sequence:CCGGCCATCCAAGATGATCTTCCTTCTCGAGAAGGAAGATCATCTTGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018936.2-336s1c1
Sequence:CCGGCAGGGTCGTTTCCAAAGGAAACTCGAGTTTCCTTTGGAAACGACCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-267s21c1
Sequence:CCGGTGGCTCCTTTGTGGCCAATTTCTCGAGAAATTGGCCACAAAGGAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-652s21c1
Sequence:CCGGTACACAATCAGTCCCAATTTCCTCGAGGAAATTGGGACTGATTGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-1079s21c1
Sequence:CCGGTCCAGACATACACAGTAAATACTCGAGTATTTACTGTGTATGTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-2554s21c1
Sequence:CCGGTGAGGCTAGTCTCGTTTAATTCTCGAGAATTAAACGAGACTAGCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-505s21c1
Sequence:CCGGCTACGGATTAGGGACGTAAATCTCGAGATTTACGTCCCTAATCCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-1182s21c1
Sequence:CCGGACTAACTATGTCGACACTTATCTCGAGATAAGTGTCGACATAGTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-694s21c1
Sequence:CCGGGACAGTCTCGATGGCATAATACTCGAGTATTATGCCATCGAGACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018936
VALIDATED
PCDHB2 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018936.2-174s21c1
Sequence:CCGGACAAAGGCAAGTCCTGATATTCTCGAGAATATCAGGACTTGCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018936.2-1080s1c1
Sequence:CCGGCCAGACATACACAGTAAATATCTCGAGATATTTACTGTGTATGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018936.2-941s1c1
Sequence:CCGGCCAGGGATTTAGACATTGGAACTCGAGTTCCAATGTCTAAATCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018936.2-504s1c1
Sequence:CCGGGCTACGGATTAGGGACGTAAACTCGAGTTTACGTCCCTAATCCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018936.2-1295s1c1
Sequence:CCGGCCATCCAAGATGATCTTCCTTCTCGAGAAGGAAGATCATCTTGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018936.2-336s1c1
Sequence:CCGGCAGGGTCGTTTCCAAAGGAAACTCGAGTTTCCTTTGGAAACGACCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-267s21c1
Sequence:CCGGTGGCTCCTTTGTGGCCAATTTCTCGAGAAATTGGCCACAAAGGAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-652s21c1
Sequence:CCGGTACACAATCAGTCCCAATTTCCTCGAGGAAATTGGGACTGATTGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-1079s21c1
Sequence:CCGGTCCAGACATACACAGTAAATACTCGAGTATTTACTGTGTATGTCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-2554s21c1
Sequence:CCGGTGAGGCTAGTCTCGTTTAATTCTCGAGAATTAAACGAGACTAGCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-505s21c1
Sequence:CCGGCTACGGATTAGGGACGTAAATCTCGAGATTTACGTCCCTAATCCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-1182s21c1
Sequence:CCGGACTAACTATGTCGACACTTATCTCGAGATAAGTGTCGACATAGTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018936.2-694s21c1
Sequence:CCGGGACAGTCTCGATGGCATAATACTCGAGTATTATGCCATCGAGACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)