EMAIL THIS PAGE TO A FRIEND

PCDHB3

protocadherin beta 3

63 Gene Product Result for
Synonyms: PCDH-BETA3
UniProtKB ID: Q9Y5E6, B2R8P2
Gene ID:
Human(56132) Summary: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Mouse(93874) protocadherin beta 3
Rat(291656) protocadherin beta 3
domestic guinea pig(100718800) protocadherin beta 3
domestic cat(101093988) protocadherin beta 3
dog(487170) protocadherin beta 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018937 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053128 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053128 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053128 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU004061 MISSION® esiRNA esiRNA targeting mouse Pcdhb3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018937 Rosetta Predictions human pricing
NM_001014783 Rosetta Predictions rat pricing
XM_001055054 Rosetta Predictions rat pricing
XM_001064424 Rosetta Predictions rat pricing
NM_053128 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352394 predicted 506
2 SASI_Hs01_00113468 predicted 346
3 SASI_Hs01_00113469 predicted 1121
4 SASI_Hs01_00113470 predicted 284
5 SASI_Hs01_00113471 predicted 732
6 SASI_Hs01_00113472 predicted 447
7 SASI_Hs01_00113473 predicted 960
8 SASI_Hs01_00113474 predicted 2398
9 SASI_Hs01_00113475 predicted 795
10 SASI_Hs01_00113476 predicted 569
11 SASI_Hs01_00113467 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014783 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201882 predicted 1036
2 SASI_Rn02_00201883 predicted 2208
3 SASI_Rn02_00201884 predicted 892
4 SASI_Rn02_00201885 predicted 2229
5 SASI_Rn02_00201886 predicted 340
6 SASI_Rn02_00201887 predicted 721
7 SASI_Rn02_00201888 predicted 1133
8 SASI_Rn02_00201889 predicted 505
9 SASI_Rn02_00201890 predicted 1159
10 SASI_Rn02_00201891 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278268 predicted 1033
2 SASI_Rn02_00278269 predicted 2207
3 SASI_Rn02_00278270 predicted 892
4 SASI_Rn02_00278271 predicted 2225
5 SASI_Rn02_00278272 predicted 340
6 SASI_Rn02_00278273 predicted 726
7 SASI_Rn02_00278274 predicted 1137
8 SASI_Rn02_00278275 predicted 503
9 SASI_Rn02_00278276 predicted 1167
10 SASI_Rn02_00278277 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064424 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310440 predicted 1036
2 SASI_Rn02_00310441 predicted 2212
3 SASI_Rn02_00310442 predicted 894
4 SASI_Rn02_00310443 predicted 2225
5 SASI_Rn02_00310444 predicted 336
6 SASI_Rn02_00310445 predicted 725
7 SASI_Rn02_00310446 predicted 1132
8 SASI_Rn02_00310447 predicted 506
9 SASI_Rn02_00310448 predicted 1161
10 SASI_Rn02_00310449 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053128 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080321 predicted 798
2 SASI_Mm01_00080322 predicted 1062
3 SASI_Mm01_00080323 predicted 910
4 SASI_Mm01_00080324 predicted 945
5 SASI_Mm02_00337646 predicted 1175
6 SASI_Mm01_00080325 predicted 1364
7 SASI_Mm01_00080326 predicted 872
8 SASI_Mm01_00080330 predicted 1229
9 SASI_Mm02_00337647 predicted 374
10 SASI_Mm02_00337648 predicted 1007
11 SASI_Mm01_00080327 predicted 2426
12 SASI_Mm01_00080328 predicted 2394
13 SASI_Mm01_00080329 predicted 2340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018937
PCDHB3 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018937.2-2583s21c1
Sequence:CCGGTTTGTATTTCAATCGAGAATCCTCGAGGATTCTCGATTGAAATACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018937.2-2683s21c1
Sequence:CCGGGGCTTGCCAACGCAGTCTTAACTCGAGTTAAGACTGCGTTGGCAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018937.2-686s21c1
Sequence:CCGGACATCCAGGTCTTAGATATAACTCGAGTTATATCTAAGACCTGGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018937.2-80s21c1
Sequence:CCGGGGTCCGAGTCAAGACGCTATTCTCGAGAATAGCGTCTTGACTCGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018937.2-360s1c1
Sequence:CCGGGCTCCGTATCATAGATGTAAACTCGAGTTTACATCTATGATACGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018937.2-574s1c1
Sequence:CCGGCCGGAACTAGTACTGGATAAACTCGAGTTTATCCAGTACTAGTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018937.2-441s1c1
Sequence:CCGGGCCAGGAACAGTAATTCCTTTCTCGAGAAAGGAATTACTGTTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018937.2-1048s1c1
Sequence:CCGGTCTTCAGTAAACAGCCCTATTCTCGAGAATAGGGCTGTTTACTGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018937.2-898s1c1
Sequence:CCGGGATATGCAACTGGTCAAATATCTCGAGATATTTGACCAGTTGCATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018937
PCDHB3 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018937.2-2583s21c1
Sequence:CCGGTTTGTATTTCAATCGAGAATCCTCGAGGATTCTCGATTGAAATACAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018937.2-2683s21c1
Sequence:CCGGGGCTTGCCAACGCAGTCTTAACTCGAGTTAAGACTGCGTTGGCAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018937.2-686s21c1
Sequence:CCGGACATCCAGGTCTTAGATATAACTCGAGTTATATCTAAGACCTGGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018937.2-80s21c1
Sequence:CCGGGGTCCGAGTCAAGACGCTATTCTCGAGAATAGCGTCTTGACTCGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018937.2-360s1c1
Sequence:CCGGGCTCCGTATCATAGATGTAAACTCGAGTTTACATCTATGATACGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018937.2-574s1c1
Sequence:CCGGCCGGAACTAGTACTGGATAAACTCGAGTTTATCCAGTACTAGTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018937.2-441s1c1
Sequence:CCGGGCCAGGAACAGTAATTCCTTTCTCGAGAAAGGAATTACTGTTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018937.2-1048s1c1
Sequence:CCGGTCTTCAGTAAACAGCCCTATTCTCGAGAATAGGGCTGTTTACTGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018937.2-898s1c1
Sequence:CCGGGATATGCAACTGGTCAAATATCTCGAGATATTTGACCAGTTGCATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018937
PCDHB3 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018937.2-2583s21c1
Sequence:CCGGTTTGTATTTCAATCGAGAATCCTCGAGGATTCTCGATTGAAATACAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018937.2-2683s21c1
Sequence:CCGGGGCTTGCCAACGCAGTCTTAACTCGAGTTAAGACTGCGTTGGCAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018937.2-686s21c1
Sequence:CCGGACATCCAGGTCTTAGATATAACTCGAGTTATATCTAAGACCTGGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018937.2-80s21c1
Sequence:CCGGGGTCCGAGTCAAGACGCTATTCTCGAGAATAGCGTCTTGACTCGGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018937.2-360s1c1
Sequence:CCGGGCTCCGTATCATAGATGTAAACTCGAGTTTACATCTATGATACGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018937.2-574s1c1
Sequence:CCGGCCGGAACTAGTACTGGATAAACTCGAGTTTATCCAGTACTAGTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018937.2-441s1c1
Sequence:CCGGGCCAGGAACAGTAATTCCTTTCTCGAGAAAGGAATTACTGTTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018937.2-1048s1c1
Sequence:CCGGTCTTCAGTAAACAGCCCTATTCTCGAGAATAGGGCTGTTTACTGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018937.2-898s1c1
Sequence:CCGGGATATGCAACTGGTCAAATATCTCGAGATATTTGACCAGTTGCATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053128
PCDHB3 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053128.1-2611s1c1
Sequence:CCGGGCGATGATTATCCTAACAGTTCTCGAGAACTGTTAGGATAATCATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053128.1-330s1c1
Sequence:CCGGGCATGATCCTTTGCAGTTTATCTCGAGATAAACTGCAAAGGATCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053128.1-2311s1c1
Sequence:CCGGCCGGTGATACCAAACCTGTTTCTCGAGAAACAGGTTTGGTATCACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053128.1-2061s1c1
Sequence:CCGGGCTCACGTTGTACTTAGTCATCTCGAGATGACTAAGTACAACGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053128.1-1183s1c1
Sequence:CCGGCCATCTGTAGAGAACTTCTATCTCGAGATAGAAGTTCTCTACAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053128
PCDHB3 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053128.1-2611s1c1
Sequence:CCGGGCGATGATTATCCTAACAGTTCTCGAGAACTGTTAGGATAATCATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053128.1-330s1c1
Sequence:CCGGGCATGATCCTTTGCAGTTTATCTCGAGATAAACTGCAAAGGATCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053128.1-2311s1c1
Sequence:CCGGCCGGTGATACCAAACCTGTTTCTCGAGAAACAGGTTTGGTATCACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053128.1-2061s1c1
Sequence:CCGGGCTCACGTTGTACTTAGTCATCTCGAGATGACTAAGTACAACGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053128.1-1183s1c1
Sequence:CCGGCCATCTGTAGAGAACTTCTATCTCGAGATAGAAGTTCTCTACAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053128
PCDHB3 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053128.1-2611s1c1
Sequence:CCGGGCGATGATTATCCTAACAGTTCTCGAGAACTGTTAGGATAATCATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053128.1-330s1c1
Sequence:CCGGGCATGATCCTTTGCAGTTTATCTCGAGATAAACTGCAAAGGATCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053128.1-2311s1c1
Sequence:CCGGCCGGTGATACCAAACCTGTTTCTCGAGAAACAGGTTTGGTATCACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053128.1-2061s1c1
Sequence:CCGGGCTCACGTTGTACTTAGTCATCTCGAGATGACTAAGTACAACGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053128.1-1183s1c1
Sequence:CCGGCCATCTGTAGAGAACTTCTATCTCGAGATAGAAGTTCTCTACAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)