EMAIL THIS PAGE TO A FRIEND

PCDHB4

protocadherin beta 4

63 Gene Product Result for
Synonyms: PCDH-BETA4
UniProtKB ID: Q9Y5E5, Q4V761
Gene ID:
Human(56131) Summary: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Mouse(93875) protocadherin beta 4
Rat(291655) protocadherin beta 4
chicken(776073) protocadherin beta 4
Horse(100061682) protocadherin beta 4
domestic cat(101094233) protocadherin beta 4
dog(487171) protocadherin beta 4
cow(786553) protocadherin beta 4
sheep(101102059) protocadherin beta 4
domestic guinea pig(100719634) protocadherin beta 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018938 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053129 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053129 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053129 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018938 Rosetta Predictions human pricing
NM_001114601 Rosetta Predictions rat pricing
XM_001064484 Rosetta Predictions rat pricing
NM_053129 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077182 predicted 2311
2 SASI_Hs01_00077183 predicted 525
3 SASI_Hs01_00077184 predicted 238
4 SASI_Hs01_00077185 predicted 1136
5 SASI_Hs01_00077186 predicted 442
6 SASI_Hs01_00077187 predicted 344
7 SASI_Hs01_00077188 predicted 680
8 SASI_Hs01_00077189 predicted 2398
9 SASI_Hs02_00352395 predicted 2379
10 SASI_Hs01_00077190 predicted 2370
11 SASI_Hs01_00077191 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252293 predicted 1098
2 SASI_Rn02_00252294 predicted 846
3 SASI_Rn02_00252295 predicted 893
4 SASI_Rn02_00252296 predicted 476
5 SASI_Rn02_00252297 predicted 304
6 SASI_Rn02_00252298 predicted 1099
7 SASI_Rn02_00252299 predicted 199
8 SASI_Rn02_00252300 predicted 1027
9 SASI_Rn02_00252301 predicted 858
10 SASI_Rn02_00252302 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064484 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310682 predicted 1093
2 SASI_Rn02_00310683 predicted 848
3 SASI_Rn02_00310684 predicted 894
4 SASI_Rn02_00310685 predicted 475
5 SASI_Rn02_00310686 predicted 306
6 SASI_Rn02_00310687 predicted 1099
7 SASI_Rn02_00310688 predicted 207
8 SASI_Rn02_00310689 predicted 1028
9 SASI_Rn02_00310690 predicted 860
10 SASI_Rn02_00310691 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121658 predicted 901
2 SASI_Mm01_00121659 predicted 1464
3 SASI_Mm01_00121660 predicted 2499
4 SASI_Mm01_00121661 predicted 2606
5 SASI_Mm01_00121663 predicted 205
6 SASI_Mm01_00121664 predicted 1099
7 SASI_Mm01_00121665 predicted 2608
8 SASI_Mm01_00121666 predicted 225
9 SASI_Mm01_00121667 predicted 2515
10 SASI_Mm02_00337649 predicted 2515
11 SASI_Mm01_00121662 predicted 2242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018938
PCDHB4 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018938.2-84s1c1
Sequence:CCGGGCCTATTCGTTATTCTGTGTTCTCGAGAACACAGAATAACGAATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018938.2-2361s1c1
Sequence:CCGGGTTCAGAAATAGCTTGGTATTCTCGAGAATACCAAGCTATTTCTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018938.2-1085s1c1
Sequence:CCGGCGGTAGTCTCTATCTTCCGAACTCGAGTTCGGAAGATAGAGACTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018938.2-298s1c1
Sequence:CCGGCCGTGTGTACTGCATTTCCAACTCGAGTTGGAAATGCAGTACACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018938.2-1153s1c1
Sequence:CCGGCCAGATAATCTACCGTTTATTCTCGAGAATAAACGGTAGATTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018938
PCDHB4 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018938.2-84s1c1
Sequence:CCGGGCCTATTCGTTATTCTGTGTTCTCGAGAACACAGAATAACGAATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018938.2-2361s1c1
Sequence:CCGGGTTCAGAAATAGCTTGGTATTCTCGAGAATACCAAGCTATTTCTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018938.2-1085s1c1
Sequence:CCGGCGGTAGTCTCTATCTTCCGAACTCGAGTTCGGAAGATAGAGACTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018938.2-298s1c1
Sequence:CCGGCCGTGTGTACTGCATTTCCAACTCGAGTTGGAAATGCAGTACACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018938.2-1153s1c1
Sequence:CCGGCCAGATAATCTACCGTTTATTCTCGAGAATAAACGGTAGATTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018938
PCDHB4 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018938.2-84s1c1
Sequence:CCGGGCCTATTCGTTATTCTGTGTTCTCGAGAACACAGAATAACGAATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018938.2-2361s1c1
Sequence:CCGGGTTCAGAAATAGCTTGGTATTCTCGAGAATACCAAGCTATTTCTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018938.2-1085s1c1
Sequence:CCGGCGGTAGTCTCTATCTTCCGAACTCGAGTTCGGAAGATAGAGACTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018938.2-298s1c1
Sequence:CCGGCCGTGTGTACTGCATTTCCAACTCGAGTTGGAAATGCAGTACACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018938.2-1153s1c1
Sequence:CCGGCCAGATAATCTACCGTTTATTCTCGAGAATAAACGGTAGATTATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053129
PCDHB4 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053129.2-3127s1c1
Sequence:CCGGCGCAGTTCAAATGTAGAGTATCTCGAGATACTCTACATTTGAACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053129.2-2505s1c1
Sequence:CCGGCCAGACAATTACATGTTGAATCTCGAGATTCAACATGTAATTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053129.2-2223s1c1
Sequence:CCGGGAAGATAATCTCACGCTGTATCTCGAGATACAGCGTGAGATTATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053129.2-896s1c1
Sequence:CCGGCCAGTTTGTACAATCGCTCTACTCGAGTAGAGCGATTGTACAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053129.2-1255s1c1
Sequence:CCGGCAGAGACTGTCGTTGCAGTTTCTCGAGAAACTGCAACGACAGTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053129
PCDHB4 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053129.2-3127s1c1
Sequence:CCGGCGCAGTTCAAATGTAGAGTATCTCGAGATACTCTACATTTGAACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053129.2-2505s1c1
Sequence:CCGGCCAGACAATTACATGTTGAATCTCGAGATTCAACATGTAATTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053129.2-2223s1c1
Sequence:CCGGGAAGATAATCTCACGCTGTATCTCGAGATACAGCGTGAGATTATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053129.2-896s1c1
Sequence:CCGGCCAGTTTGTACAATCGCTCTACTCGAGTAGAGCGATTGTACAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053129.2-1255s1c1
Sequence:CCGGCAGAGACTGTCGTTGCAGTTTCTCGAGAAACTGCAACGACAGTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053129
PCDHB4 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053129.2-3127s1c1
Sequence:CCGGCGCAGTTCAAATGTAGAGTATCTCGAGATACTCTACATTTGAACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053129.2-2505s1c1
Sequence:CCGGCCAGACAATTACATGTTGAATCTCGAGATTCAACATGTAATTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053129.2-2223s1c1
Sequence:CCGGGAAGATAATCTCACGCTGTATCTCGAGATACAGCGTGAGATTATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053129.2-896s1c1
Sequence:CCGGCCAGTTTGTACAATCGCTCTACTCGAGTAGAGCGATTGTACAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053129.2-1255s1c1
Sequence:CCGGCAGAGACTGTCGTTGCAGTTTCTCGAGAAACTGCAACGACAGTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)