EMAIL THIS PAGE TO A FRIEND

PCDHB5

protocadherin beta 5

57 Gene Product Result for
Synonyms: PCDH-BETA5
UniProtKB ID: Q9Y5E4, Q549F4, Q9UFU9
Gene ID:
Human(26167) Summary: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Mouse(93876) protocadherin beta 5
Rat(291654) protocadherin beta 5
domestic guinea pig(100716949) protocadherin beta 5
cow(786489) protocadherin beta 5
sheep(101122861) protocadherin beta 5
domestic cat(101094476) protocadherin beta 5
dog(487172) protocadherin beta 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053130 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053130 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053130 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015669 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015669 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015669 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU019171 MISSION® esiRNA esiRNA targeting mouse Pcdhb5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015669 Rosetta Predictions human pricing
NM_001114602 Rosetta Predictions rat pricing
XM_001055177 Rosetta Predictions rat pricing
NM_053130 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082326 predicted 1126
2 SASI_Hs02_00348299 predicted 1014
3 SASI_Hs01_00082328 predicted 1140
4 SASI_Hs01_00082330 predicted 2466
5 SASI_Hs02_00348300 predicted 1066
6 SASI_Hs01_00082331 predicted 1077
7 SASI_Hs01_00082333 predicted 263
8 SASI_Hs01_00082334 predicted 572
9 SASI_Hs01_00082335 predicted 724
10 SASI_Hs02_00348301 predicted 888
11 SASI_Hs01_00082327 predicted 2588
12 SASI_Hs01_00082329 predicted 2631
13 SASI_Hs01_00082332 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252303 predicted 1265
2 SASI_Rn02_00252304 predicted 425
3 SASI_Rn02_00252305 predicted 1320
4 SASI_Rn02_00252306 predicted 1342
5 SASI_Rn02_00252307 predicted 799
6 SASI_Rn02_00252308 predicted 869
7 SASI_Rn02_00252309 predicted 1969
8 SASI_Rn02_00252310 predicted 1118
9 SASI_Rn02_00252311 predicted 1176
10 SASI_Rn02_00252312 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055177 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278722 predicted 1265
2 SASI_Rn02_00278723 predicted 429
3 SASI_Rn02_00278724 predicted 1321
4 SASI_Rn02_00278725 predicted 1343
5 SASI_Rn02_00278726 predicted 798
6 SASI_Rn02_00278727 predicted 864
7 SASI_Rn02_00278728 predicted 1973
8 SASI_Rn02_00278729 predicted 1121
9 SASI_Rn02_00278730 predicted 1173
10 SASI_Rn02_00278731 predicted 1282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070213 predicted 2431
2 SASI_Mm01_00070214 predicted 2651
3 SASI_Mm01_00070215 predicted 1315
4 SASI_Mm02_00337650 predicted 204
5 SASI_Mm01_00070216 predicted 1280
6 SASI_Mm01_00070217 predicted 402
7 SASI_Mm01_00070218 predicted 2632
8 SASI_Mm01_00070219 predicted 1113
9 SASI_Mm01_00070221 predicted 578
10 SASI_Mm01_00070222 predicted 277
11 SASI_Mm01_00070220 predicted 1118
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053130
PCDHB5 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053130.2-1265s1c1
Sequence:CCGGGTGGTCGCTATCATCCGAATACTCGAGTATTCGGATGATAGCGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053130.2-383s1c1
Sequence:CCGGCATGACAAACAGCAATTCATTCTCGAGAATGAATTGCTGTTTGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053130.2-2507s1c1
Sequence:CCGGGTTCAGGATACGGGAAATCTTCTCGAGAAGATTTCCCGTATCCTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053130.2-2856s1c1
Sequence:CCGGGCTCTTTCATTGAAGTTTCATCTCGAGATGAAACTTCAATGAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053130.2-386s1c1
Sequence:CCGGGACAAACAGCAATTCATTCTACTCGAGTAGAATGAATTGCTGTTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053130
PCDHB5 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053130.2-1265s1c1
Sequence:CCGGGTGGTCGCTATCATCCGAATACTCGAGTATTCGGATGATAGCGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053130.2-383s1c1
Sequence:CCGGCATGACAAACAGCAATTCATTCTCGAGAATGAATTGCTGTTTGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053130.2-2507s1c1
Sequence:CCGGGTTCAGGATACGGGAAATCTTCTCGAGAAGATTTCCCGTATCCTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053130.2-2856s1c1
Sequence:CCGGGCTCTTTCATTGAAGTTTCATCTCGAGATGAAACTTCAATGAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053130.2-386s1c1
Sequence:CCGGGACAAACAGCAATTCATTCTACTCGAGTAGAATGAATTGCTGTTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053130
PCDHB5 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053130.2-1265s1c1
Sequence:CCGGGTGGTCGCTATCATCCGAATACTCGAGTATTCGGATGATAGCGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053130.2-383s1c1
Sequence:CCGGCATGACAAACAGCAATTCATTCTCGAGAATGAATTGCTGTTTGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053130.2-2507s1c1
Sequence:CCGGGTTCAGGATACGGGAAATCTTCTCGAGAAGATTTCCCGTATCCTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053130.2-2856s1c1
Sequence:CCGGGCTCTTTCATTGAAGTTTCATCTCGAGATGAAACTTCAATGAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053130.2-386s1c1
Sequence:CCGGGACAAACAGCAATTCATTCTACTCGAGTAGAATGAATTGCTGTTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015669
VALIDATED
PCDHB5 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000365671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-1139s21c1
Sequence:CCGGTTCGAGGCAACTCCATATTATCTCGAGATAATATGGAGTTGCCTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-749s21c1
Sequence:CCGGTTTCATGTTGCTACGCATAATCTCGAGATTATGCGTAGCAACATGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015669.2-2631s1c1
Sequence:CCGGCTGCCATTTATCCCAAACTTTCTCGAGAAAGTTTGGGATAAATGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015669.2-2549s1c1
Sequence:CCGGGCTGGTGAAGAAATAGGGAAACTCGAGTTTCCCTATTTCTTCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015669.2-687s1c1
Sequence:CCGGCCCAGGACTTTGACATAGGTACTCGAGTACCTATGTCAAAGTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_015669.2-1069s1c1
Sequence:CCGGCGATGAAGTTACTCAACCATTCTCGAGAATGGTTGAGTAACTTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015669.2-1296s1c1
Sequence:CCGGCGGAAACTGTAGTTGCCGTTTCTCGAGAAACGGCAACTACAGTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-1341s21c1
Sequence:CCGGGGGACAACGGTAGGATGATTTCTCGAGAAATCATCCTACCGTTGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-2580s21c1
Sequence:CCGGTCCGGAATAGCTTTGGATTAACTCGAGTTAATCCAAAGCTATTCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-297s21c1
Sequence:CCGGGCTCTGAGGCAGTTAGGTATTCTCGAGAATACCTAACTGCCTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-448s21c1
Sequence:CCGGTGATATAAAGACCGGCAATTTCTCGAGAAATTGCCGGTCTTTATATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-577s21c1
Sequence:CCGGTCTGCAGCTCACAGATATAAACTCGAGTTTATATCTGTGAGCTGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-2609s21c1
Sequence:CCGGTCTCGTGATGACGCGTTGTTTCTCGAGAAACAACGCGTCATCACGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015669
VALIDATED
PCDHB5 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000365671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-1139s21c1
Sequence:CCGGTTCGAGGCAACTCCATATTATCTCGAGATAATATGGAGTTGCCTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-749s21c1
Sequence:CCGGTTTCATGTTGCTACGCATAATCTCGAGATTATGCGTAGCAACATGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015669.2-2631s1c1
Sequence:CCGGCTGCCATTTATCCCAAACTTTCTCGAGAAAGTTTGGGATAAATGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015669.2-2549s1c1
Sequence:CCGGGCTGGTGAAGAAATAGGGAAACTCGAGTTTCCCTATTTCTTCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015669.2-687s1c1
Sequence:CCGGCCCAGGACTTTGACATAGGTACTCGAGTACCTATGTCAAAGTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_015669.2-1069s1c1
Sequence:CCGGCGATGAAGTTACTCAACCATTCTCGAGAATGGTTGAGTAACTTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015669.2-1296s1c1
Sequence:CCGGCGGAAACTGTAGTTGCCGTTTCTCGAGAAACGGCAACTACAGTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-1341s21c1
Sequence:CCGGGGGACAACGGTAGGATGATTTCTCGAGAAATCATCCTACCGTTGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-2580s21c1
Sequence:CCGGTCCGGAATAGCTTTGGATTAACTCGAGTTAATCCAAAGCTATTCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-297s21c1
Sequence:CCGGGCTCTGAGGCAGTTAGGTATTCTCGAGAATACCTAACTGCCTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-448s21c1
Sequence:CCGGTGATATAAAGACCGGCAATTTCTCGAGAAATTGCCGGTCTTTATATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-577s21c1
Sequence:CCGGTCTGCAGCTCACAGATATAAACTCGAGTTTATATCTGTGAGCTGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-2609s21c1
Sequence:CCGGTCTCGTGATGACGCGTTGTTTCTCGAGAAACAACGCGTCATCACGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015669
VALIDATED
PCDHB5 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000365671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-1139s21c1
Sequence:CCGGTTCGAGGCAACTCCATATTATCTCGAGATAATATGGAGTTGCCTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-749s21c1
Sequence:CCGGTTTCATGTTGCTACGCATAATCTCGAGATTATGCGTAGCAACATGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015669.2-2631s1c1
Sequence:CCGGCTGCCATTTATCCCAAACTTTCTCGAGAAAGTTTGGGATAAATGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015669.2-2549s1c1
Sequence:CCGGGCTGGTGAAGAAATAGGGAAACTCGAGTTTCCCTATTTCTTCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015669.2-687s1c1
Sequence:CCGGCCCAGGACTTTGACATAGGTACTCGAGTACCTATGTCAAAGTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_015669.2-1069s1c1
Sequence:CCGGCGATGAAGTTACTCAACCATTCTCGAGAATGGTTGAGTAACTTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015669.2-1296s1c1
Sequence:CCGGCGGAAACTGTAGTTGCCGTTTCTCGAGAAACGGCAACTACAGTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-1341s21c1
Sequence:CCGGGGGACAACGGTAGGATGATTTCTCGAGAAATCATCCTACCGTTGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-2580s21c1
Sequence:CCGGTCCGGAATAGCTTTGGATTAACTCGAGTTAATCCAAAGCTATTCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-297s21c1
Sequence:CCGGGCTCTGAGGCAGTTAGGTATTCTCGAGAATACCTAACTGCCTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-448s21c1
Sequence:CCGGTGATATAAAGACCGGCAATTTCTCGAGAAATTGCCGGTCTTTATATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-577s21c1
Sequence:CCGGTCTGCAGCTCACAGATATAAACTCGAGTTTATATCTGTGAGCTGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015669.2-2609s21c1
Sequence:CCGGTCTCGTGATGACGCGTTGTTTCTCGAGAAACAACGCGTCATCACGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)