EMAIL THIS PAGE TO A FRIEND

PCDHB6

protocadherin beta 6

57 Gene Product Result for
Synonyms: PCDH-BETA6
UniProtKB ID: Q9Y5E3
Gene ID:
Human(56130) Summary: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Mouse(93877) protocadherin beta 6
Rat(291653) protocadherin beta 6
dog(487173) protocadherin beta 6
domestic cat(101094728) protocadherin beta 6
Horse(100072319) protocadherin beta 6
sheep(101102480) protocadherin beta 6
naked mole-rat(101729415) protocadherin beta 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053131 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053131 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053131 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018939 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018939 Rosetta Predictions human pricing
NM_001014780 Rosetta Predictions rat pricing
XM_001055233 Rosetta Predictions rat pricing
XM_001064596 Rosetta Predictions rat pricing
NM_053131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021300 predicted 927
2 SASI_Hs01_00021302 predicted 931
3 SASI_Hs01_00021303 predicted 1111
4 SASI_Hs01_00021304 predicted 1118
5 SASI_Hs01_00021305 predicted 1020
6 SASI_Hs01_00021306 predicted 792
7 SASI_Hs01_00021307 predicted 508
8 SASI_Hs01_00021308 predicted 385
9 SASI_Hs01_00021309 predicted 236
10 SASI_Hs02_00352396 predicted 2355
11 SASI_Hs01_00021301 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014780 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201872 predicted 237
2 SASI_Rn02_00201873 predicted 1505
3 SASI_Rn02_00201874 predicted 1171
4 SASI_Rn02_00201875 predicted 1178
5 SASI_Rn02_00201876 predicted 1173
6 SASI_Rn02_00201877 predicted 714
7 SASI_Rn02_00201878 predicted 2328
8 SASI_Rn02_00201879 predicted 81
9 SASI_Rn02_00201880 predicted 2270
10 SASI_Rn02_00201881 predicted 2267
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278906 predicted 234
2 SASI_Rn02_00278907 predicted 1498
3 SASI_Rn02_00278908 predicted 1177
4 SASI_Rn02_00278909 predicted 1186
5 SASI_Rn02_00278910 predicted 1172
6 SASI_Rn02_00278911 predicted 719
7 SASI_Rn02_00278912 predicted 2329
8 SASI_Rn02_00278913 predicted 86
9 SASI_Rn02_00278914 predicted 2438
10 SASI_Rn02_00278915 predicted 2436
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064596 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311123 predicted 232
2 SASI_Rn02_00311124 predicted 1499
3 SASI_Rn02_00311125 predicted 1173
4 SASI_Rn02_00311126 predicted 1182
5 SASI_Rn02_00311127 predicted 1179
6 SASI_Rn02_00311128 predicted 711
7 SASI_Rn02_00311129 predicted 2329
8 SASI_Rn02_00311130 predicted 78
9 SASI_Rn02_00311131 predicted 2438
10 SASI_Rn02_00311132 predicted 2431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195309 predicted 1669
2 SASI_Mm01_00195310 predicted 719
3 SASI_Mm01_00195311 predicted 1247
4 SASI_Mm01_00195312 predicted 1230
5 SASI_Mm01_00195313 predicted 123
6 SASI_Mm01_00195314 predicted 2199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053131
PCDHB6 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053131.1-1665s21c1
Sequence:CCGGCAATGCGCCCTTCATTCTCTACTCGAGTAGAGAATGAAGGGCGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053131.1-2055s21c1
Sequence:CCGGGCTCACACTCTACCTGGTCATCTCGAGATGACCAGGTAGAGTGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053131.1-1788s1c1
Sequence:CCGGCCAGAATGCTTGGCTGTCATTCTCGAGAATGACAGCCAAGCATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053131.1-2292s21c1
Sequence:CCGGCAAATTCCTGAACCATTATTCCTCGAGGAATAATGGTTCAGGAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053131.1-1774s21c1
Sequence:CCGGGACTCTGACTCGGGCCAGAATCTCGAGATTCTGGCCCGAGTCAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053131.1-720s1c1
Sequence:CCGGCGAATTTGTACAGTCACTCTACTCGAGTAGAGTGACTGTACAAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053131.1-811s1c1
Sequence:CCGGGCTGGGATACATGGCAATGTACTCGAGTACATTGCCATGTATCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053131.1-862s1c1
Sequence:CCGGCCTCAGCCATTTGTAATAGATCTCGAGATCTATTACAAATGGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053131.1-1677s1c1
Sequence:CCGGCATTCTCTACCCGATGCAGAACTCGAGTTCTGCATCGGGTAGAGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053131
PCDHB6 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053131.1-1665s21c1
Sequence:CCGGCAATGCGCCCTTCATTCTCTACTCGAGTAGAGAATGAAGGGCGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053131.1-2055s21c1
Sequence:CCGGGCTCACACTCTACCTGGTCATCTCGAGATGACCAGGTAGAGTGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053131.1-1788s1c1
Sequence:CCGGCCAGAATGCTTGGCTGTCATTCTCGAGAATGACAGCCAAGCATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053131.1-2292s21c1
Sequence:CCGGCAAATTCCTGAACCATTATTCCTCGAGGAATAATGGTTCAGGAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053131.1-1774s21c1
Sequence:CCGGGACTCTGACTCGGGCCAGAATCTCGAGATTCTGGCCCGAGTCAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053131.1-720s1c1
Sequence:CCGGCGAATTTGTACAGTCACTCTACTCGAGTAGAGTGACTGTACAAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053131.1-811s1c1
Sequence:CCGGGCTGGGATACATGGCAATGTACTCGAGTACATTGCCATGTATCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053131.1-862s1c1
Sequence:CCGGCCTCAGCCATTTGTAATAGATCTCGAGATCTATTACAAATGGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053131.1-1677s1c1
Sequence:CCGGCATTCTCTACCCGATGCAGAACTCGAGTTCTGCATCGGGTAGAGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053131
PCDHB6 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053131.1-1665s21c1
Sequence:CCGGCAATGCGCCCTTCATTCTCTACTCGAGTAGAGAATGAAGGGCGCATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053131.1-2055s21c1
Sequence:CCGGGCTCACACTCTACCTGGTCATCTCGAGATGACCAGGTAGAGTGTGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053131.1-1788s1c1
Sequence:CCGGCCAGAATGCTTGGCTGTCATTCTCGAGAATGACAGCCAAGCATTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053131.1-2292s21c1
Sequence:CCGGCAAATTCCTGAACCATTATTCCTCGAGGAATAATGGTTCAGGAATTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053131.1-1774s21c1
Sequence:CCGGGACTCTGACTCGGGCCAGAATCTCGAGATTCTGGCCCGAGTCAGAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053131.1-720s1c1
Sequence:CCGGCGAATTTGTACAGTCACTCTACTCGAGTAGAGTGACTGTACAAATTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053131.1-811s1c1
Sequence:CCGGGCTGGGATACATGGCAATGTACTCGAGTACATTGCCATGTATCCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053131.1-862s1c1
Sequence:CCGGCCTCAGCCATTTGTAATAGATCTCGAGATCTATTACAAATGGCTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053131.1-1677s1c1
Sequence:CCGGCATTCTCTACCCGATGCAGAACTCGAGTTCTGCATCGGGTAGAGAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018939
PCDHB6 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018939.2-765s21c1
Sequence:CCGGCCTCGGCTCTCTGGTTATTACCTCGAGGTAATAACCAGAGAGCCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018939.2-84s21c1
Sequence:CCGGATCGATTCAGTATTCCGTATTCTCGAGAATACGGAATACTGAATCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018939.2-1128s1c1
Sequence:CCGGCCAACAGGTTATTTGTTCAATCTCGAGATTGAACAAATAACCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018939.2-400s1c1
Sequence:CCGGGCCAGAGAAATGCTCCTGAAACTCGAGTTTCAGGAGCATTTCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018939.2-674s1c1
Sequence:CCGGCCGAGATTCAGATCCAGGTTTCTCGAGAAACCTGGATCTGAATCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018939.2-237s1c1
Sequence:CCGGGACCCATGATTTACTGCTAAACTCGAGTTTAGCAGTAAATCATGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018939
PCDHB6 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018939.2-765s21c1
Sequence:CCGGCCTCGGCTCTCTGGTTATTACCTCGAGGTAATAACCAGAGAGCCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018939.2-84s21c1
Sequence:CCGGATCGATTCAGTATTCCGTATTCTCGAGAATACGGAATACTGAATCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018939.2-1128s1c1
Sequence:CCGGCCAACAGGTTATTTGTTCAATCTCGAGATTGAACAAATAACCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018939.2-400s1c1
Sequence:CCGGGCCAGAGAAATGCTCCTGAAACTCGAGTTTCAGGAGCATTTCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018939.2-674s1c1
Sequence:CCGGCCGAGATTCAGATCCAGGTTTCTCGAGAAACCTGGATCTGAATCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018939.2-237s1c1
Sequence:CCGGGACCCATGATTTACTGCTAAACTCGAGTTTAGCAGTAAATCATGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018939
PCDHB6 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018939.2-765s21c1
Sequence:CCGGCCTCGGCTCTCTGGTTATTACCTCGAGGTAATAACCAGAGAGCCGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018939.2-84s21c1
Sequence:CCGGATCGATTCAGTATTCCGTATTCTCGAGAATACGGAATACTGAATCGATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018939.2-1128s1c1
Sequence:CCGGCCAACAGGTTATTTGTTCAATCTCGAGATTGAACAAATAACCTGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018939.2-400s1c1
Sequence:CCGGGCCAGAGAAATGCTCCTGAAACTCGAGTTTCAGGAGCATTTCTCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018939.2-674s1c1
Sequence:CCGGCCGAGATTCAGATCCAGGTTTCTCGAGAAACCTGGATCTGAATCTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018939.2-237s1c1
Sequence:CCGGGACCCATGATTTACTGCTAAACTCGAGTTTAGCAGTAAATCATGGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)