EMAIL THIS PAGE TO A FRIEND

PCDHB7

protocadherin beta 7

45 Gene Product Result for
Synonyms: PCDH-BETA7
UniProtKB ID: Q9Y5E2, A1L3Y8
Gene ID:
Human(56129) Summary: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. The transcript for this particular family member uses more than one polyadenylation site. [provided by RefSeq, Jul 2008]
Mouse(93878) protocadherin beta 7
Rat(291652) protocadherin beta 7
naked mole-rat(101729062) protocadherin beta 7
cow(787102) protocadherin beta 7
sheep(101123120) protocadherin beta 7
Horse(100061644) protocadherin beta 7
dog(487174) protocadherin beta 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053132 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053132 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053132 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018940 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018940 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018940 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018940 Rosetta Predictions human pricing
XM_001055294 Rosetta Predictions rat pricing
XM_001064651 Rosetta Predictions rat pricing
NM_053132 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182638 predicted 416
2 SASI_Hs01_00182639 predicted 741
3 SASI_Hs01_00182640 predicted 1161
4 SASI_Hs01_00182641 predicted 779
5 SASI_Hs01_00182642 predicted 1086
6 SASI_Hs02_00352397 predicted 1292
7 SASI_Hs01_00182644 predicted 806
8 SASI_Hs01_00182646 predicted 968
9 SASI_Hs02_00352398 predicted 2561
10 SASI_Hs01_00182647 predicted 2619
11 SASI_Hs01_00182643 predicted 555
12 SASI_Hs01_00182645 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055294 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279102 predicted 2275
2 SASI_Rn02_00279103 predicted 2374
3 SASI_Rn02_00279104 predicted 644
4 SASI_Rn02_00279105 predicted 689
5 SASI_Rn02_00279106 predicted 2208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064651 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311332 predicted 2271
2 SASI_Rn02_00311333 predicted 2381
3 SASI_Rn02_00311334 predicted 652
4 SASI_Rn02_00311335 predicted 690
5 SASI_Rn02_00311336 predicted 2203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151629 predicted 285
2 SASI_Mm01_00151630 predicted 2598
3 SASI_Mm01_00151631 predicted 2686
4 SASI_Mm01_00151632 predicted 2680
5 SASI_Mm01_00151633 predicted 1065
6 SASI_Mm01_00151637 predicted 609
7 SASI_Mm01_00151634 predicted 1325
8 SASI_Mm01_00151635 predicted 615
9 SASI_Mm01_00151636 predicted 645
10 SASI_Mm02_00337651 predicted 147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053132
PCDHB7 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053132.2-3227s1c1
Sequence:CCGGCCTGAATCTTTCTGCATGAATCTCGAGATTCATGCAGAAAGATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053132.2-2548s1c1
Sequence:CCGGCTGGGAGAGAACTTAATGAAACTCGAGTTTCATTAAGTTCTCTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053132.2-1203s1c1
Sequence:CCGGGTAATAGTAGAGGTGTTGGATCTCGAGATCCAACACCTCTACTATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053132.3-3072s21c1
Sequence:CCGGTAGTGGTCTTATAAGACATTTCTCGAGAAATGTCTTATAAGACCACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053132.2-652s1c1
Sequence:CCGGGCACTCTGTTACCACTGAATTCTCGAGAATTCAGTGGTAACAGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053132.2-1199s1c1
Sequence:CCGGCTTGGTAATAGTAGAGGTGTTCTCGAGAACACCTCTACTATTACCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053132.3-1695s21c1
Sequence:CCGGGCTGCCACTCTCCTCGTTAATCTCGAGATTAACGAGGAGAGTGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053132.3-3029s21c1
Sequence:CCGGGTACTCTGATAAGCCTAAATACTCGAGTATTTAGGCTTATCAGAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053132
PCDHB7 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053132.2-3227s1c1
Sequence:CCGGCCTGAATCTTTCTGCATGAATCTCGAGATTCATGCAGAAAGATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053132.2-2548s1c1
Sequence:CCGGCTGGGAGAGAACTTAATGAAACTCGAGTTTCATTAAGTTCTCTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053132.2-1203s1c1
Sequence:CCGGGTAATAGTAGAGGTGTTGGATCTCGAGATCCAACACCTCTACTATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053132.3-3072s21c1
Sequence:CCGGTAGTGGTCTTATAAGACATTTCTCGAGAAATGTCTTATAAGACCACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053132.2-652s1c1
Sequence:CCGGGCACTCTGTTACCACTGAATTCTCGAGAATTCAGTGGTAACAGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053132.2-1199s1c1
Sequence:CCGGCTTGGTAATAGTAGAGGTGTTCTCGAGAACACCTCTACTATTACCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053132.3-1695s21c1
Sequence:CCGGGCTGCCACTCTCCTCGTTAATCTCGAGATTAACGAGGAGAGTGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053132.3-3029s21c1
Sequence:CCGGGTACTCTGATAAGCCTAAATACTCGAGTATTTAGGCTTATCAGAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053132
PCDHB7 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053132.2-3227s1c1
Sequence:CCGGCCTGAATCTTTCTGCATGAATCTCGAGATTCATGCAGAAAGATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053132.2-2548s1c1
Sequence:CCGGCTGGGAGAGAACTTAATGAAACTCGAGTTTCATTAAGTTCTCTCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053132.2-1203s1c1
Sequence:CCGGGTAATAGTAGAGGTGTTGGATCTCGAGATCCAACACCTCTACTATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053132.3-3072s21c1
Sequence:CCGGTAGTGGTCTTATAAGACATTTCTCGAGAAATGTCTTATAAGACCACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053132.2-652s1c1
Sequence:CCGGGCACTCTGTTACCACTGAATTCTCGAGAATTCAGTGGTAACAGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053132.2-1199s1c1
Sequence:CCGGCTTGGTAATAGTAGAGGTGTTCTCGAGAACACCTCTACTATTACCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053132.3-1695s21c1
Sequence:CCGGGCTGCCACTCTCCTCGTTAATCTCGAGATTAACGAGGAGAGTGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053132.3-3029s21c1
Sequence:CCGGGTACTCTGATAAGCCTAAATACTCGAGTATTTAGGCTTATCAGAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018940
PCDHB7 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018940.2-1073s1c1
Sequence:CCGGGTCTTCATCTTAAAGCGCAATCTCGAGATTGCGCTTTAAGATGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018940.2-748s1c1
Sequence:CCGGCCCGAATTGGTGCTGAATCAACTCGAGTTGATTCAGCACCAATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018940.2-302s1c1
Sequence:CCGGCCTTTCTTACCAACTTGGCAACTCGAGTTGCCAAGTTGGTAAGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018940.2-695s1c1
Sequence:CCGGCCAATGCCTATTTCCATATTACTCGAGTAATATGGAAATAGGCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018940.2-1384s1c1
Sequence:CCGGGTAACAGAGAAACCTTTGGATCTCGAGATCCAAAGGTTTCTCTGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018940.2-862s21c1
Sequence:CCGGATTCTGGTTCTAGACGTAAATCTCGAGATTTACGTCTAGAACCAGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018940.2-414s21c1
Sequence:CCGGTACTGGTGATCTACTTCTAAACTCGAGTTTAGAAGTAGATCACCAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018940.2-799s21c1
Sequence:CCGGAGTTTAACCCTCACCGCTTTACTCGAGTAAAGCGGTGAGGGTTAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018940.2-976s21c1
Sequence:CCGGGATTTAGATACCGGAAGTAATCTCGAGATTACTTCCGGTATCTAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018940.2-1176s21c1
Sequence:CCGGGGTTGATGTAACAGATATAAACTCGAGTTTATATCTGTTACATCAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018940
PCDHB7 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018940.2-1073s1c1
Sequence:CCGGGTCTTCATCTTAAAGCGCAATCTCGAGATTGCGCTTTAAGATGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018940.2-748s1c1
Sequence:CCGGCCCGAATTGGTGCTGAATCAACTCGAGTTGATTCAGCACCAATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018940.2-302s1c1
Sequence:CCGGCCTTTCTTACCAACTTGGCAACTCGAGTTGCCAAGTTGGTAAGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018940.2-695s1c1
Sequence:CCGGCCAATGCCTATTTCCATATTACTCGAGTAATATGGAAATAGGCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018940.2-1384s1c1
Sequence:CCGGGTAACAGAGAAACCTTTGGATCTCGAGATCCAAAGGTTTCTCTGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018940.2-862s21c1
Sequence:CCGGATTCTGGTTCTAGACGTAAATCTCGAGATTTACGTCTAGAACCAGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018940.2-414s21c1
Sequence:CCGGTACTGGTGATCTACTTCTAAACTCGAGTTTAGAAGTAGATCACCAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018940.2-799s21c1
Sequence:CCGGAGTTTAACCCTCACCGCTTTACTCGAGTAAAGCGGTGAGGGTTAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018940.2-976s21c1
Sequence:CCGGGATTTAGATACCGGAAGTAATCTCGAGATTACTTCCGGTATCTAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018940.2-1176s21c1
Sequence:CCGGGGTTGATGTAACAGATATAAACTCGAGTTTATATCTGTTACATCAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018940
PCDHB7 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018940.2-1073s1c1
Sequence:CCGGGTCTTCATCTTAAAGCGCAATCTCGAGATTGCGCTTTAAGATGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018940.2-748s1c1
Sequence:CCGGCCCGAATTGGTGCTGAATCAACTCGAGTTGATTCAGCACCAATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018940.2-302s1c1
Sequence:CCGGCCTTTCTTACCAACTTGGCAACTCGAGTTGCCAAGTTGGTAAGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018940.2-695s1c1
Sequence:CCGGCCAATGCCTATTTCCATATTACTCGAGTAATATGGAAATAGGCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018940.2-1384s1c1
Sequence:CCGGGTAACAGAGAAACCTTTGGATCTCGAGATCCAAAGGTTTCTCTGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018940.2-862s21c1
Sequence:CCGGATTCTGGTTCTAGACGTAAATCTCGAGATTTACGTCTAGAACCAGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018940.2-414s21c1
Sequence:CCGGTACTGGTGATCTACTTCTAAACTCGAGTTTAGAAGTAGATCACCAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018940.2-799s21c1
Sequence:CCGGAGTTTAACCCTCACCGCTTTACTCGAGTAAAGCGGTGAGGGTTAAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018940.2-976s21c1
Sequence:CCGGGATTTAGATACCGGAAGTAATCTCGAGATTACTTCCGGTATCTAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018940.2-1176s21c1
Sequence:CCGGGGTTGATGTAACAGATATAAACTCGAGTTTATATCTGTTACATCAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)