EMAIL THIS PAGE TO A FRIEND

PCDHB8

protocadherin beta 8

41 Gene Product Result for
Synonyms: PCDH-BETA8 PCDH3I
UniProtKB ID: Q9UN66
Gene ID:
Human(56128) Summary: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Mouse(93879) protocadherin beta 8
Rat(680020) protocadherin beta 8
dog(487177) protocadherin beta 8
domestic cat(101080696) protocadherin beta 8
cow(518612) protocadherin beta 8
sheep(101123376) protocadherin beta 8
naked mole-rat(101697277) protocadherin beta 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019120 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053133 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053133 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053133 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109511 MISSION® esiRNA esiRNA human PCDHB8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019120 Rosetta Predictions human pricing
NM_001014779 Rosetta Predictions rat pricing
XM_001055350 Rosetta Predictions rat pricing
NM_053133 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135630 predicted 1074
2 SASI_Hs01_00135631 predicted 1394
3 SASI_Hs01_00135632 predicted 2547
4 SASI_Hs01_00135633 predicted 2486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201863 predicted 1432
2 SASI_Rn02_00201864 predicted 1368
3 SASI_Rn02_00201865 predicted 1352
4 SASI_Rn02_00201866 predicted 720
5 SASI_Rn02_00201867 predicted 1135
6 SASI_Rn02_00201868 predicted 1356
7 SASI_Rn02_00201869 predicted 2167
8 SASI_Rn02_00201870 predicted 41
9 SASI_Rn02_00201871 predicted 2239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279285 predicted 1437
2 SASI_Rn02_00279286 predicted 1362
3 SASI_Rn02_00279287 predicted 1354
4 SASI_Rn02_00279288 predicted 712
5 SASI_Rn02_00279289 predicted 1129
6 SASI_Rn02_00279290 predicted 1356
7 SASI_Rn02_00279291 predicted 2173
8 SASI_Rn02_00279292 predicted 39
9 SASI_Rn02_00279293 predicted 2242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053133 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089556 predicted 1355
2 SASI_Mm01_00089557 predicted 1442
3 SASI_Mm01_00089558 predicted 355
4 SASI_Mm01_00089559 predicted 719
5 SASI_Mm01_00089560 predicted 1354
6 SASI_Mm01_00089561 predicted 1354
7 SASI_Mm01_00089562 predicted 2244
8 SASI_Mm01_00089563 predicted 2230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019120
VALIDATED
PCDHB8 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 8
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-878s21c1
Sequence:CCGGTTGAAGTTGTCGATGTCAATGCTCGAGCATTGACATCGACAACTTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-1034s21c1
Sequence:CCGGTCCAAGCTTCAGATGAGATAACTCGAGTTATCTCATCTGAAGCTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-1478s21c1
Sequence:CCGGGGCTGACAACACATCTCAATACTCGAGTATTGAGATGTGTTGTCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-941s21c1
Sequence:CCGGTCTCTGAGGACAGTCCAATAACTCGAGTTATTGGACTGTCCTCAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-548s21c1
Sequence:CCGGAGCTGCAAGTAATAGACATAACTCGAGTTATGTCTATTACTTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-1432s21c1
Sequence:CCGGGCCGAGTACAACGTCACTATCCTCGAGGATAGTGACGTTGTACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-654s21c1
Sequence:CCGGGAATGCTGAAGACTTAGATATCTCGAGATATCTAAGTCTTCAGCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-420s21c1
Sequence:CCGGCAATCAGGAGACCGCGGATTTCTCGAGAAATCCGCGGTCTCCTGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019120.2-311s1c1
Sequence:CCGGGCAGCTCCTTTGTCACCAATTCTCGAGAATTGGTGACAAAGGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019120.2-1039s1c1
Sequence:CCGGGCTTCAGATGAGATAAGCAAACTCGAGTTTGCTTATCTCATCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019120.2-1071s1c1
Sequence:CCGGCGATTTCTTGACAGGAGAAATCTCGAGATTTCTCCTGTCAAGAAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019120.2-1093s1c1
Sequence:CCGGCGACTAAAGAAACAACTTGATCTCGAGATCAAGTTGTTTCTTTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_019120.2-2421s1c1
Sequence:CCGGCCTGTCTCAGAACTATCAGTACTCGAGTACTGATAGTTCTGAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019120
VALIDATED
PCDHB8 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 8
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-878s21c1
Sequence:CCGGTTGAAGTTGTCGATGTCAATGCTCGAGCATTGACATCGACAACTTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-1034s21c1
Sequence:CCGGTCCAAGCTTCAGATGAGATAACTCGAGTTATCTCATCTGAAGCTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-1478s21c1
Sequence:CCGGGGCTGACAACACATCTCAATACTCGAGTATTGAGATGTGTTGTCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-941s21c1
Sequence:CCGGTCTCTGAGGACAGTCCAATAACTCGAGTTATTGGACTGTCCTCAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-548s21c1
Sequence:CCGGAGCTGCAAGTAATAGACATAACTCGAGTTATGTCTATTACTTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-1432s21c1
Sequence:CCGGGCCGAGTACAACGTCACTATCCTCGAGGATAGTGACGTTGTACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-654s21c1
Sequence:CCGGGAATGCTGAAGACTTAGATATCTCGAGATATCTAAGTCTTCAGCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-420s21c1
Sequence:CCGGCAATCAGGAGACCGCGGATTTCTCGAGAAATCCGCGGTCTCCTGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019120.2-311s1c1
Sequence:CCGGGCAGCTCCTTTGTCACCAATTCTCGAGAATTGGTGACAAAGGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019120.2-1039s1c1
Sequence:CCGGGCTTCAGATGAGATAAGCAAACTCGAGTTTGCTTATCTCATCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019120.2-1071s1c1
Sequence:CCGGCGATTTCTTGACAGGAGAAATCTCGAGATTTCTCCTGTCAAGAAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019120.2-1093s1c1
Sequence:CCGGCGACTAAAGAAACAACTTGATCTCGAGATCAAGTTGTTTCTTTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_019120.2-2421s1c1
Sequence:CCGGCCTGTCTCAGAACTATCAGTACTCGAGTACTGATAGTTCTGAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019120
VALIDATED
PCDHB8 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 8
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-878s21c1
Sequence:CCGGTTGAAGTTGTCGATGTCAATGCTCGAGCATTGACATCGACAACTTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-1034s21c1
Sequence:CCGGTCCAAGCTTCAGATGAGATAACTCGAGTTATCTCATCTGAAGCTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-1478s21c1
Sequence:CCGGGGCTGACAACACATCTCAATACTCGAGTATTGAGATGTGTTGTCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-941s21c1
Sequence:CCGGTCTCTGAGGACAGTCCAATAACTCGAGTTATTGGACTGTCCTCAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-548s21c1
Sequence:CCGGAGCTGCAAGTAATAGACATAACTCGAGTTATGTCTATTACTTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-1432s21c1
Sequence:CCGGGCCGAGTACAACGTCACTATCCTCGAGGATAGTGACGTTGTACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-654s21c1
Sequence:CCGGGAATGCTGAAGACTTAGATATCTCGAGATATCTAAGTCTTCAGCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019120.2-420s21c1
Sequence:CCGGCAATCAGGAGACCGCGGATTTCTCGAGAAATCCGCGGTCTCCTGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019120.2-311s1c1
Sequence:CCGGGCAGCTCCTTTGTCACCAATTCTCGAGAATTGGTGACAAAGGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019120.2-1039s1c1
Sequence:CCGGGCTTCAGATGAGATAAGCAAACTCGAGTTTGCTTATCTCATCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019120.2-1071s1c1
Sequence:CCGGCGATTTCTTGACAGGAGAAATCTCGAGATTTCTCCTGTCAAGAAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019120.2-1093s1c1
Sequence:CCGGCGACTAAAGAAACAACTTGATCTCGAGATCAAGTTGTTTCTTTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_019120.2-2421s1c1
Sequence:CCGGCCTGTCTCAGAACTATCAGTACTCGAGTACTGATAGTTCTGAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053133
PCDHB8 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053133.1-2055s1c1
Sequence:CCGGGCTCACTCTCTATCTGGTTATCTCGAGATAACCAGATAGAGAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053133.1-1436s1c1
Sequence:CCGGCTGGCTCCAATGGCCTTATTACTCGAGTAATAAGGCCATTGGAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053133.1-369s1c1
Sequence:CCGGCACAGATATAAACGACCATTTCTCGAGAAATGGTCGTTTATATCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053133.1-1449s1c1
Sequence:CCGGCCTTATTATCTACTCGTTGCTCTCGAGAGCAACGAGTAGATAATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053133.1-357s1c1
Sequence:CCGGAGACTTGCAGTTCACAGATATCTCGAGATATCTGTGAACTGCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053133
PCDHB8 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053133.1-2055s1c1
Sequence:CCGGGCTCACTCTCTATCTGGTTATCTCGAGATAACCAGATAGAGAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053133.1-1436s1c1
Sequence:CCGGCTGGCTCCAATGGCCTTATTACTCGAGTAATAAGGCCATTGGAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053133.1-369s1c1
Sequence:CCGGCACAGATATAAACGACCATTTCTCGAGAAATGGTCGTTTATATCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053133.1-1449s1c1
Sequence:CCGGCCTTATTATCTACTCGTTGCTCTCGAGAGCAACGAGTAGATAATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053133.1-357s1c1
Sequence:CCGGAGACTTGCAGTTCACAGATATCTCGAGATATCTGTGAACTGCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053133
PCDHB8 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053133.1-2055s1c1
Sequence:CCGGGCTCACTCTCTATCTGGTTATCTCGAGATAACCAGATAGAGAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053133.1-1436s1c1
Sequence:CCGGCTGGCTCCAATGGCCTTATTACTCGAGTAATAAGGCCATTGGAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053133.1-369s1c1
Sequence:CCGGCACAGATATAAACGACCATTTCTCGAGAAATGGTCGTTTATATCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053133.1-1449s1c1
Sequence:CCGGCCTTATTATCTACTCGTTGCTCTCGAGAGCAACGAGTAGATAATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053133.1-357s1c1
Sequence:CCGGAGACTTGCAGTTCACAGATATCTCGAGATATCTGTGAACTGCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)