EMAIL THIS PAGE TO A FRIEND

PCDHGA10

protocadherin gamma subfamily A, 10

135 Gene Product Result for
Synonyms: PCDH-GAMMA-A10
UniProtKB ID: Q9Y5H3, Q9Y5E0
Gene ID:
Human(56106) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93722) protocadherin gamma subfamily A, 10
Rat(498849) protocadherin gamma subfamily A, 10
dog(487184) protocadherin gamma subfamily A, 10
domestic cat(101100180) protocadherin gamma subfamily A, 10
Horse(100072224) protocadherin gamma subfamily A, 10
cow(539554) protocadherin gamma subfamily A, 10
sheep(101104577) protocadherin gamma subfamily A, 10
domestic guinea pig(100722477) protocadherin gamma subfamily A, 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033593 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033593 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033593 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018913 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018913 Rosetta Predictions human pricing
NM_032090 Rosetta Predictions human pricing
NM_001037135 Rosetta Predictions rat pricing
XM_574134 Rosetta Predictions rat pricing
NM_033593 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128241 predicted 978
2 SASI_Hs01_00128242 predicted 572
3 SASI_Hs01_00128243 predicted 1195
4 SASI_Hs01_00128244 predicted 868
5 SASI_Hs02_00352349 predicted 1315
6 SASI_Hs01_00128247 predicted 1378
7 SASI_Hs01_00128248 predicted 1508
8 SASI_Hs01_00128249 predicted 840
9 SASI_Hs01_00128250 predicted 1126
10 SASI_Hs02_00352350 predicted 1252
11 SASI_Hs01_00128245 predicted 1459
12 SASI_Hs01_00128246 predicted 1178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202257 predicted 978
2 SASI_Hs01_00202258 predicted 572
3 SASI_Hs01_00202259 predicted 1196
4 SASI_Hs01_00202260 predicted 868
5 SASI_Hs02_00359266 predicted 1318
6 SASI_Hs01_00202263 predicted 1371
7 SASI_Hs01_00202264 predicted 1507
8 SASI_Hs01_00202265 predicted 839
9 SASI_Hs01_00202266 predicted 1128
10 SASI_Hs02_00359267 predicted 1249
11 SASI_Hs01_00202261 predicted 1458
12 SASI_Hs01_00202262 predicted 1174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075212 predicted 2800
2 SASI_Rn01_00075213 predicted 1296
3 SASI_Rn02_00204230 predicted 2663
4 SASI_Rn01_00075215 predicted 997
5 SASI_Rn01_00075216 predicted 1381
6 SASI_Rn01_00075217 predicted 1583
7 SASI_Rn01_00075218 predicted 1451
8 SASI_Rn01_00075219 predicted 1973
9 SASI_Rn01_00075220 predicted 2347
10 SASI_Rn01_00075221 predicted 1636
11 SASI_Rn01_00075214 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00130919 predicted 1150
2 SASI_Rn01_00130920 predicted 544
3 SASI_Rn01_00130921 predicted 863
4 SASI_Rn01_00130922 predicted 1236
5 SASI_Rn01_00130923 predicted 1443
6 SASI_Rn01_00130924 predicted 1303
7 SASI_Rn01_00130925 predicted 1834
8 SASI_Rn01_00130926 predicted 1491
9 SASI_Rn01_00130927 predicted 1616
10 SASI_Rn01_00130928 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162597 predicted 2650
2 SASI_Mm02_00337452 predicted 2704
3 SASI_Mm02_00337453 predicted 2675
4 SASI_Mm01_00162598 predicted 2048
5 SASI_Mm01_00162599 predicted 1094
6 SASI_Mm01_00162600 predicted 1612
7 SASI_Mm01_00162601 predicted 1214
8 SASI_Mm01_00162603 predicted 722
9 SASI_Mm01_00162604 predicted 2244
10 SASI_Mm01_00162605 predicted 539
11 SASI_Mm01_00162602 predicted 1023
12 SASI_Mm01_00162606 predicted 1902
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033593
PCDHGA10 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 10
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033593.2-4539s1c1
Sequence:CCGGCCCTGTACTGACTTCTCTATACTCGAGTATAGAGAAGTCAGTACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033593.2-1645s1c1
Sequence:CCGGCGCCACTTTCTTCCTACATATCTCGAGATATGTAGGAAGAAAGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033593.2-1248s1c1
Sequence:CCGGGCCCTACTAAACGTCCATGATCTCGAGATCATGGACGTTTAGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033593.2-2324s1c1
Sequence:CCGGGCAGTCTTCGAGAGATGGATTCTCGAGAATCCATCTCTCGAAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033593.2-1395s1c1
Sequence:CCGGCCCGCTTACAACATCACAGTACTCGAGTACTGTGATGTTGTAAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033593.3-2247s21c1
Sequence:CCGGGACCTATTCGCACGAGGTTTCCTCGAGGAAACCTCGTGCGAATAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033593.3-1628s21c1
Sequence:CCGGATGTGTCGTTGACTCTGTTTGCTCGAGCAAACAGAGTCAACGACACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033593.3-1181s21c1
Sequence:CCGGAGTCCATTGACAATTACTATACTCGAGTATAGTAATTGTCAATGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033593
PCDHGA10 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 10
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033593.2-4539s1c1
Sequence:CCGGCCCTGTACTGACTTCTCTATACTCGAGTATAGAGAAGTCAGTACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033593.2-1645s1c1
Sequence:CCGGCGCCACTTTCTTCCTACATATCTCGAGATATGTAGGAAGAAAGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033593.2-1248s1c1
Sequence:CCGGGCCCTACTAAACGTCCATGATCTCGAGATCATGGACGTTTAGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033593.2-2324s1c1
Sequence:CCGGGCAGTCTTCGAGAGATGGATTCTCGAGAATCCATCTCTCGAAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033593.2-1395s1c1
Sequence:CCGGCCCGCTTACAACATCACAGTACTCGAGTACTGTGATGTTGTAAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033593.3-2247s21c1
Sequence:CCGGGACCTATTCGCACGAGGTTTCCTCGAGGAAACCTCGTGCGAATAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033593.3-1628s21c1
Sequence:CCGGATGTGTCGTTGACTCTGTTTGCTCGAGCAAACAGAGTCAACGACACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033593.3-1181s21c1
Sequence:CCGGAGTCCATTGACAATTACTATACTCGAGTATAGTAATTGTCAATGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033593
PCDHGA10 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 10
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033593.2-4539s1c1
Sequence:CCGGCCCTGTACTGACTTCTCTATACTCGAGTATAGAGAAGTCAGTACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033593.2-1645s1c1
Sequence:CCGGCGCCACTTTCTTCCTACATATCTCGAGATATGTAGGAAGAAAGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033593.2-1248s1c1
Sequence:CCGGGCCCTACTAAACGTCCATGATCTCGAGATCATGGACGTTTAGTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033593.2-2324s1c1
Sequence:CCGGGCAGTCTTCGAGAGATGGATTCTCGAGAATCCATCTCTCGAAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033593.2-1395s1c1
Sequence:CCGGCCCGCTTACAACATCACAGTACTCGAGTACTGTGATGTTGTAAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033593.3-2247s21c1
Sequence:CCGGGACCTATTCGCACGAGGTTTCCTCGAGGAAACCTCGTGCGAATAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033593.3-1628s21c1
Sequence:CCGGATGTGTCGTTGACTCTGTTTGCTCGAGCAAACAGAGTCAACGACACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033593.3-1181s21c1
Sequence:CCGGAGTCCATTGACAATTACTATACTCGAGTATAGTAATTGTCAATGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018913
PCDHGA10 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018913.2-947s1c1
Sequence:CCGGCCGGTTTCTATGAAATAGAAACTCGAGTTTCTATTTCATAGAAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018913.2-532s1c1
Sequence:CCGGCCCAATAAGCACTTCTCCCTACTCGAGTAGGGAGAAGTGCTTATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018913.2-754s1c1
Sequence:CCGGCGAGTGAGTGTTCCTGAGAATCTCGAGATTCTCAGGAACACTCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018913.2-1050s1c1
Sequence:CCGGGCTGACCATCACGTCTCTATTCTCGAGAATAGAGACGTGATGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018913.2-107s1c1
Sequence:CCGGCCTACTCAATTCCTGAGGAATCTCGAGATTCCTCAGGAATTGAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018913.2-1375s21c1
Sequence:CCGGGTCTCCTACTTTACCTATATCCTCGAGGATATAGGTAAAGTAGGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018913.2-1307s21c1
Sequence:CCGGTATCAACGGAAGCTCACTTTACTCGAGTAAAGTGAGCTTCCGTTGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018913.2-1559s21c1
Sequence:CCGGCACTCAGATCCTTCGACTATGCTCGAGCATAGTCGAAGGATCTGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018913
PCDHGA10 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018913.2-947s1c1
Sequence:CCGGCCGGTTTCTATGAAATAGAAACTCGAGTTTCTATTTCATAGAAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018913.2-532s1c1
Sequence:CCGGCCCAATAAGCACTTCTCCCTACTCGAGTAGGGAGAAGTGCTTATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018913.2-754s1c1
Sequence:CCGGCGAGTGAGTGTTCCTGAGAATCTCGAGATTCTCAGGAACACTCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018913.2-1050s1c1
Sequence:CCGGGCTGACCATCACGTCTCTATTCTCGAGAATAGAGACGTGATGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018913.2-107s1c1
Sequence:CCGGCCTACTCAATTCCTGAGGAATCTCGAGATTCCTCAGGAATTGAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018913.2-1375s21c1
Sequence:CCGGGTCTCCTACTTTACCTATATCCTCGAGGATATAGGTAAAGTAGGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018913.2-1307s21c1
Sequence:CCGGTATCAACGGAAGCTCACTTTACTCGAGTAAAGTGAGCTTCCGTTGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018913.2-1559s21c1
Sequence:CCGGCACTCAGATCCTTCGACTATGCTCGAGCATAGTCGAAGGATCTGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018913
PCDHGA10 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018913.2-947s1c1
Sequence:CCGGCCGGTTTCTATGAAATAGAAACTCGAGTTTCTATTTCATAGAAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018913.2-532s1c1
Sequence:CCGGCCCAATAAGCACTTCTCCCTACTCGAGTAGGGAGAAGTGCTTATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018913.2-754s1c1
Sequence:CCGGCGAGTGAGTGTTCCTGAGAATCTCGAGATTCTCAGGAACACTCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018913.2-1050s1c1
Sequence:CCGGGCTGACCATCACGTCTCTATTCTCGAGAATAGAGACGTGATGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018913.2-107s1c1
Sequence:CCGGCCTACTCAATTCCTGAGGAATCTCGAGATTCCTCAGGAATTGAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018913.2-1375s21c1
Sequence:CCGGGTCTCCTACTTTACCTATATCCTCGAGGATATAGGTAAAGTAGGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018913.2-1307s21c1
Sequence:CCGGTATCAACGGAAGCTCACTTTACTCGAGTAAAGTGAGCTTCCGTTGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018913.2-1559s21c1
Sequence:CCGGCACTCAGATCCTTCGACTATGCTCGAGCATAGTCGAAGGATCTGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)