EMAIL THIS PAGE TO A FRIEND

PCDHGA11

protocadherin gamma subfamily A, 11

142 Gene Product Result for
Synonyms: PCDH-GAMMA-A11
UniProtKB ID: Q9Y5H2, B7ZVY8, Q9Y5D8, Q9Y5D9
Gene ID:
Human(56105) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93723) protocadherin gamma subfamily A, 11
Rat(252897) protocadherin gamma subfamily A, 11
domestic guinea pig(100723028) protocadherin gamma subfamily A, 11
cow(101904103) protocadherin gamma subfamily A, 11
sheep(101105077) protocadherin gamma subfamily A, 11
dog(487185) protocadherin gamma subfamily A, 11
domestic cat(101100441) protocadherin gamma subfamily A, 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1411904 ANTI-PCDHGA11 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018914 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU188291 MISSION® esiRNA esiRNA targeting mouse Pcdhga11 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018914 Rosetta Predictions human pricing
NM_032091 Rosetta Predictions human pricing
NM_032092 Rosetta Predictions human pricing
NM_001037153 Rosetta Predictions rat pricing
NM_033594 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177000 predicted 3469
2 SASI_Hs01_00177002 predicted 3483
3 SASI_Hs01_00177004 predicted 3131
4 SASI_Hs02_00352351 predicted 3443
5 SASI_Hs01_00177005 predicted 3327
6 SASI_Hs01_00177007 predicted 3487
7 SASI_Hs01_00177008 predicted 3279
8 SASI_Hs01_00177009 predicted 3545
9 SASI_Hs02_00352352 predicted 3319
10 SASI_Hs02_00352353 predicted 3134
11 SASI_Hs01_00177001 predicted 2930
12 SASI_Hs01_00177003 predicted 2945
13 SASI_Hs01_00177006 predicted 2975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077708 predicted 1259
2 SASI_Hs02_00359268 predicted 347
3 SASI_Hs02_00359269 predicted 1290
4 SASI_Hs01_00077712 predicted 1718
5 SASI_Hs02_00359270 predicted 351
6 SASI_Hs01_00077713 predicted 1453
7 SASI_Hs01_00077714 predicted 991
8 SASI_Hs01_00077715 predicted 1125
9 SASI_Hs01_00077716 predicted 986
10 SASI_Hs01_00077717 predicted 1587
11 SASI_Hs01_00077709 predicted 1625
12 SASI_Hs01_00077710 predicted 1130
13 SASI_Hs01_00077711 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119962 predicted 2909
2 SASI_Hs01_00119964 predicted 2932
3 SASI_Hs01_00119966 predicted 2580
4 SASI_Hs02_00359271 predicted 2880
5 SASI_Hs01_00119967 predicted 2768
6 SASI_Hs01_00119969 predicted 2931
7 SASI_Hs01_00119970 predicted 2725
8 SASI_Hs01_00119971 predicted 2984
9 SASI_Hs02_00359272 predicted 2762
10 SASI_Hs02_00359273 predicted 2580
11 SASI_Hs01_00119963 predicted 2376
12 SASI_Hs01_00119965 predicted 2398
13 SASI_Hs01_00119968 predicted 2424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036165 predicted 2799
2 SASI_Rn01_00036166 predicted 1381
3 SASI_Rn02_00204237 predicted 2665
4 SASI_Rn01_00036167 predicted 203
5 SASI_Rn01_00036169 predicted 1162
6 SASI_Rn01_00036170 predicted 1369
7 SASI_Rn01_00036171 predicted 498
8 SASI_Rn01_00036172 predicted 833
9 SASI_Rn01_00036173 predicted 2530
10 SASI_Rn01_00036174 predicted 2375
11 SASI_Rn01_00036168 predicted 2058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041855 predicted 2832
2 SASI_Mm02_00337454 predicted 2881
3 SASI_Mm02_00337455 predicted 519
4 SASI_Mm02_00337456 predicted 1410
5 SASI_Mm01_00041857 predicted 1256
6 SASI_Mm01_00041858 predicted 1273
7 SASI_Mm01_00041859 predicted 1832
8 SASI_Mm01_00041860 predicted 683
9 SASI_Mm01_00041861 predicted 1213
10 SASI_Mm01_00041862 predicted 1524
11 SASI_Mm01_00041853 predicted 2535
12 SASI_Mm01_00041854 predicted 2070
13 SASI_Mm01_00041856 predicted 898
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018914
PCDHGA11 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018914.2-982s21c1
Sequence:CCGGATGTTTACACAGTCCGTATATCTCGAGATATACGGACTGTGTAAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018914.2-2641s1c1
Sequence:CCGGGCTGAAGACTCAGCTATCATTCTCGAGAATGATAGCTGAGTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018914.2-1360s1c1
Sequence:CCGGGCTCTTCTAAATGTGCAAGATCTCGAGATCTTGCACATTTAGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018914.2-1807s1c1
Sequence:CCGGGCCCTACAATCCTTCGACTATCTCGAGATAGTCGAAGGATTGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018914.2-709s1c1
Sequence:CCGGGCGCGATTTGCTCTTCCTAATCTCGAGATTAGGAAGAGCAAATCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018914.2-957s1c1
Sequence:CCGGCCTCGATGTAAATGATCACATCTCGAGATGTGATCATTTACATCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018914.2-1502s21c1
Sequence:CCGGTGGTCCAGAGCTACAATATAACTCGAGTTATATTGTAGCTCTGGACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018914
PCDHGA11 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018914.2-982s21c1
Sequence:CCGGATGTTTACACAGTCCGTATATCTCGAGATATACGGACTGTGTAAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018914.2-2641s1c1
Sequence:CCGGGCTGAAGACTCAGCTATCATTCTCGAGAATGATAGCTGAGTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018914.2-1360s1c1
Sequence:CCGGGCTCTTCTAAATGTGCAAGATCTCGAGATCTTGCACATTTAGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018914.2-1807s1c1
Sequence:CCGGGCCCTACAATCCTTCGACTATCTCGAGATAGTCGAAGGATTGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018914.2-709s1c1
Sequence:CCGGGCGCGATTTGCTCTTCCTAATCTCGAGATTAGGAAGAGCAAATCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018914.2-957s1c1
Sequence:CCGGCCTCGATGTAAATGATCACATCTCGAGATGTGATCATTTACATCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018914.2-1502s21c1
Sequence:CCGGTGGTCCAGAGCTACAATATAACTCGAGTTATATTGTAGCTCTGGACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018914
PCDHGA11 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018914.2-982s21c1
Sequence:CCGGATGTTTACACAGTCCGTATATCTCGAGATATACGGACTGTGTAAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018914.2-2641s1c1
Sequence:CCGGGCTGAAGACTCAGCTATCATTCTCGAGAATGATAGCTGAGTCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018914.2-1360s1c1
Sequence:CCGGGCTCTTCTAAATGTGCAAGATCTCGAGATCTTGCACATTTAGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018914.2-1807s1c1
Sequence:CCGGGCCCTACAATCCTTCGACTATCTCGAGATAGTCGAAGGATTGTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018914.2-709s1c1
Sequence:CCGGGCGCGATTTGCTCTTCCTAATCTCGAGATTAGGAAGAGCAAATCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018914.2-957s1c1
Sequence:CCGGCCTCGATGTAAATGATCACATCTCGAGATGTGATCATTTACATCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018914.2-1502s21c1
Sequence:CCGGTGGTCCAGAGCTACAATATAACTCGAGTTATATTGTAGCTCTGGACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033594
PCDHGA11 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033594.2-1786s1c1
Sequence:CCGGCCACCATTAAGCAGCAATATTCTCGAGAATATTGCTGCTTAATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033594.2-4562s1c1
Sequence:CCGGCCTGTACTGACTTCTCTATAACTCGAGTTATAGAGAAGTCAGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033594.2-901s1c1
Sequence:CCGGCCTGTGTATAGAGTGAGTATTCTCGAGAATACTCACTCTATACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033594.2-1917s1c1
Sequence:CCGGGCCGGGTTATTTAGTGACCAACTCGAGTTGGTCACTAAATAACCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033594.2-1785s1c1
Sequence:CCGGCCCACCATTAAGCAGCAATATCTCGAGATATTGCTGCTTAATGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033594
PCDHGA11 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033594.2-1786s1c1
Sequence:CCGGCCACCATTAAGCAGCAATATTCTCGAGAATATTGCTGCTTAATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033594.2-4562s1c1
Sequence:CCGGCCTGTACTGACTTCTCTATAACTCGAGTTATAGAGAAGTCAGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033594.2-901s1c1
Sequence:CCGGCCTGTGTATAGAGTGAGTATTCTCGAGAATACTCACTCTATACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033594.2-1917s1c1
Sequence:CCGGGCCGGGTTATTTAGTGACCAACTCGAGTTGGTCACTAAATAACCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033594.2-1785s1c1
Sequence:CCGGCCCACCATTAAGCAGCAATATCTCGAGATATTGCTGCTTAATGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033594
PCDHGA11 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033594.2-1786s1c1
Sequence:CCGGCCACCATTAAGCAGCAATATTCTCGAGAATATTGCTGCTTAATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033594.2-4562s1c1
Sequence:CCGGCCTGTACTGACTTCTCTATAACTCGAGTTATAGAGAAGTCAGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033594.2-901s1c1
Sequence:CCGGCCTGTGTATAGAGTGAGTATTCTCGAGAATACTCACTCTATACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033594.2-1917s1c1
Sequence:CCGGGCCGGGTTATTTAGTGACCAACTCGAGTTGGTCACTAAATAACCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033594.2-1785s1c1
Sequence:CCGGCCCACCATTAAGCAGCAATATCTCGAGATATTGCTGCTTAATGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)