EMAIL THIS PAGE TO A FRIEND

PCDHGA12

protocadherin gamma subfamily A, 12

127 Gene Product Result for
Synonyms: CDH21 FIB3 PCDH-GAMMA-A12
UniProtKB ID: O60330, O15100, Q6UW70, Q9Y5D7
Gene ID:
Human(26025) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93724) protocadherin gamma subfamily A, 12
Rat(498850) protocadherin gamma subfamily A, 12
Horse(100072207) protocadherin gamma subfamily A, 12
dog(100684816) protocadherin gamma subfamily A, 12
domestic cat(101100942) protocadherin gamma subfamily A, 12
sheep(101105572) protocadherin gamma subfamily A, 12
domestic guinea pig(100723576) protocadherin gamma subfamily A, 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407275 Anti-PCDHGA12 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003735 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003735 Rosetta Predictions human pricing
NM_032094 Rosetta Predictions human pricing
NM_001037337 Rosetta Predictions rat pricing
NM_033595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140841 predicted 1125
2 SASI_Hs01_00140842 predicted 463
3 SASI_Hs01_00140843 predicted 1381
4 SASI_Hs02_00336187 predicted 1406
5 SASI_Hs01_00140845 predicted 1354
6 SASI_Hs01_00140846 predicted 1529
7 SASI_Hs01_00140847 predicted 547
8 SASI_Hs01_00140848 predicted 1631
9 SASI_Hs02_00336188 predicted 1319
10 SASI_Hs01_00140849 predicted 977
11 SASI_Hs01_00140844 predicted 487
12 SASI_Hs01_00140850 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170523 predicted 1130
2 SASI_Hs01_00170524 predicted 458
3 SASI_Hs01_00170525 predicted 1386
4 SASI_Hs02_00359274 predicted 1409
5 SASI_Hs01_00170527 predicted 1356
6 SASI_Hs01_00170528 predicted 1530
7 SASI_Hs01_00170529 predicted 547
8 SASI_Hs01_00170530 predicted 1623
9 SASI_Hs02_00359275 predicted 1325
10 SASI_Hs01_00170531 predicted 979
11 SASI_Hs01_00170526 predicted 486
12 SASI_Hs01_00170532 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046160 predicted 2848
2 SASI_Rn01_00046161 predicted 1009
3 SASI_Rn02_00204368 predicted 2713
4 SASI_Rn01_00046162 predicted 2503
5 SASI_Rn01_00046163 predicted 311
6 SASI_Rn01_00046164 predicted 582
7 SASI_Rn01_00046165 predicted 1143
8 SASI_Rn01_00046167 predicted 1591
9 SASI_Rn01_00046168 predicted 1429
10 SASI_Rn02_00204369 predicted 2500
11 SASI_Rn01_00046166 predicted 1391
12 SASI_Rn01_00046169 predicted 2422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068535 predicted 3201
2 SASI_Mm02_00337457 predicted 3243
3 SASI_Mm01_00068536 predicted 2041
4 SASI_Mm01_00068538 predicted 2553
5 SASI_Mm01_00068539 predicted 1912
6 SASI_Mm01_00068540 predicted 3216
7 SASI_Mm02_00337458 predicted 3284
8 SASI_Mm01_00068541 predicted 658
9 SASI_Mm02_00337459 predicted 1778
10 SASI_Mm02_00337460 predicted 1534
11 SASI_Mm01_00068534 predicted 865
12 SASI_Mm01_00068537 predicted 1704
13 SASI_Mm01_00068542 predicted 926
14 SASI_Mm01_00068543 predicted 942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033595
PCDHGA12 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033595.3-3818s1c1
Sequence:CCGGCGGTAGGGAGAGTATTACAATCTCGAGATTGTAATACTCTCCCTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033595.3-1498s1c1
Sequence:CCGGGCTACAGATAACGCGGGATATCTCGAGATATCCCGCGTTATCTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033595.3-2554s1c1
Sequence:CCGGGCAGATCTAGACAATCTAGAACTCGAGTTCTAGATTGTCTAGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033595.3-1694s1c1
Sequence:CCGGTCCAAGAGAATCTGCCCTTTACTCGAGTAAAGGGCAGATTCTCTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033595.3-1089s1c1
Sequence:CCGGCGGAGCTGATGGTAACAAGTACTCGAGTACTTGTTACCATCAGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033595
PCDHGA12 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033595.3-3818s1c1
Sequence:CCGGCGGTAGGGAGAGTATTACAATCTCGAGATTGTAATACTCTCCCTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033595.3-1498s1c1
Sequence:CCGGGCTACAGATAACGCGGGATATCTCGAGATATCCCGCGTTATCTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033595.3-2554s1c1
Sequence:CCGGGCAGATCTAGACAATCTAGAACTCGAGTTCTAGATTGTCTAGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033595.3-1694s1c1
Sequence:CCGGTCCAAGAGAATCTGCCCTTTACTCGAGTAAAGGGCAGATTCTCTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033595.3-1089s1c1
Sequence:CCGGCGGAGCTGATGGTAACAAGTACTCGAGTACTTGTTACCATCAGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033595
PCDHGA12 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033595.3-3818s1c1
Sequence:CCGGCGGTAGGGAGAGTATTACAATCTCGAGATTGTAATACTCTCCCTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033595.3-1498s1c1
Sequence:CCGGGCTACAGATAACGCGGGATATCTCGAGATATCCCGCGTTATCTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033595.3-2554s1c1
Sequence:CCGGGCAGATCTAGACAATCTAGAACTCGAGTTCTAGATTGTCTAGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033595.3-1694s1c1
Sequence:CCGGTCCAAGAGAATCTGCCCTTTACTCGAGTAAAGGGCAGATTCTCTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033595.3-1089s1c1
Sequence:CCGGCGGAGCTGATGGTAACAAGTACTCGAGTACTTGTTACCATCAGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003735
PCDHGA12 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 12
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003735.2-1130s1c1
Sequence:CCGGGCAATGGATAATGCAGGATATCTCGAGATATCCTGCATTATCCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003735.2-2546s1c1
Sequence:CCGGCTGTCAGGTGATTCGGTATTTCTCGAGAAATACCGAATCACCTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003735.2-1543s1c1
Sequence:CCGGCGCTTATATCCCAGAGAACAACTCGAGTTGTTCTCTGGGATATAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003735.2-1327s1c1
Sequence:CCGGCCAAGGAAATCTGCCCTTTAACTCGAGTTAAAGGGCAGATTTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003735.2-464s1c1
Sequence:CCGGGCCATCAAGTGTCAATTAAATCTCGAGATTTAATTGACACTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003735.2-1054s21c1
Sequence:CCGGTTGTAATTCAGGGACAATATCCTCGAGGATATTGTCCCTGAATTACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003735.2-2569s21c1
Sequence:CCGGTAAAGACAGTCATGGGTTAATCTCGAGATTAACCCATGACTGTCTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003735
PCDHGA12 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 12
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003735.2-1130s1c1
Sequence:CCGGGCAATGGATAATGCAGGATATCTCGAGATATCCTGCATTATCCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003735.2-2546s1c1
Sequence:CCGGCTGTCAGGTGATTCGGTATTTCTCGAGAAATACCGAATCACCTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003735.2-1543s1c1
Sequence:CCGGCGCTTATATCCCAGAGAACAACTCGAGTTGTTCTCTGGGATATAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003735.2-1327s1c1
Sequence:CCGGCCAAGGAAATCTGCCCTTTAACTCGAGTTAAAGGGCAGATTTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003735.2-464s1c1
Sequence:CCGGGCCATCAAGTGTCAATTAAATCTCGAGATTTAATTGACACTTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003735.2-1054s21c1
Sequence:CCGGTTGTAATTCAGGGACAATATCCTCGAGGATATTGTCCCTGAATTACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003735.2-2569s21c1
Sequence:CCGGTAAAGACAGTCATGGGTTAATCTCGAGATTAACCCATGACTGTCTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003735
PCDHGA12 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 12
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003735.2-1130s1c1
Sequence:CCGGGCAATGGATAATGCAGGATATCTCGAGATATCCTGCATTATCCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003735.2-2546s1c1
Sequence:CCGGCTGTCAGGTGATTCGGTATTTCTCGAGAAATACCGAATCACCTGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003735.2-1543s1c1
Sequence:CCGGCGCTTATATCCCAGAGAACAACTCGAGTTGTTCTCTGGGATATAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003735.2-1327s1c1
Sequence:CCGGCCAAGGAAATCTGCCCTTTAACTCGAGTTAAAGGGCAGATTTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003735.2-464s1c1
Sequence:CCGGGCCATCAAGTGTCAATTAAATCTCGAGATTTAATTGACACTTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003735.2-1054s21c1
Sequence:CCGGTTGTAATTCAGGGACAATATCCTCGAGGATATTGTCCCTGAATTACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003735.2-2569s21c1
Sequence:CCGGTAAAGACAGTCATGGGTTAATCTCGAGATTAACCCATGACTGTCTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)