EMAIL THIS PAGE TO A FRIEND

PCDHGA1

protocadherin gamma subfamily A, 1

135 Gene Product Result for
Synonyms: PCDH-GAMMA-A1
UniProtKB ID: Q9Y5H4, Q9Y5D6
Gene ID:
Human(56114) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93709) protocadherin gamma subfamily A, 1
Rat(553129) protocadherin gamma subfamily A, 1
cow(786935) protocadherin gamma subfamily A, 1
sheep(101104745) protocadherin gamma subfamily A, 1
Horse(100072267) protocadherin gamma subfamily A, 1
domestic cat(101096946) protocadherin gamma subfamily A, 1
dog(607510) protocadherin gamma subfamily A, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036547 Anti-PCDHGA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
WH0056114M1 Monoclonal Anti-PCDHGA1 antibody produced in mouse clone 4C9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1405184 Monoclonal Anti-PCDHGA1 antibody produced in mouse clone 1D2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5201347 Monoclonal Anti-Protocadherin Gamma (Pan) - Alkaline Phosphatase antibody produced in mouse clone S159-5, purified immunoglobulin mouse, rat
immunohistochemistry, western blot pricing
SAB5201348 Monoclonal Anti-Protocadherin Gamma (Pan) - Apc antibody produced in mouse clone S159-5, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5201339 Monoclonal Anti-Protocadherin Gamma (Pan) - Atto 390 antibody produced in mouse clone S159-5, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5201340 Monoclonal Anti-Protocadherin Gamma (Pan) - Atto 488 antibody produced in mouse clone S159-5, purified immunoglobulin mouse, rat
immunohistochemistry, western blot pricing
SAB5201341 Monoclonal Anti-Protocadherin Gamma (Pan) - Atto 565 antibody produced in mouse clone S159-5, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5201342 Monoclonal Anti-Protocadherin Gamma (Pan) - Atto 594 antibody produced in mouse clone S159-5, purified immunoglobulin mouse, rat
immunohistochemistry, western blot pricing
SAB5201343 Monoclonal Anti-Protocadherin Gamma (Pan) - Atto 633 antibody produced in mouse clone S159-5, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5201344 Monoclonal Anti-Protocadherin Gamma (Pan) - Atto 655 antibody produced in mouse clone S159-5, purified immunoglobulin mouse, rat
immunohistochemistry, western blot pricing
SAB5201345 Monoclonal Anti-Protocadherin Gamma (Pan) - Atto 680 antibody produced in mouse clone S159-5, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5201346 Monoclonal Anti-Protocadherin Gamma (Pan) - Atto 700 antibody produced in mouse clone S159-5, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5201349 Monoclonal Anti-Protocadherin Gamma (Pan) - Biotin antibody produced in mouse clone S159-5, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5201350 Monoclonal Anti-Protocadherin Gamma (Pan) - Fitc antibody produced in mouse clone S159-5, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5201351 Monoclonal Anti-Protocadherin Gamma (Pan) - Hrp antibody produced in mouse clone S159-5, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5201352 Monoclonal Anti-Protocadherin Gamma (Pan) - Pe/Atto 594 antibody produced in mouse clone S159-5, purified immunoglobulin mouse, rat
immunohistochemistry, western blot pricing
SAB5201353 Monoclonal Anti-Protocadherin Gamma (Pan) - Percp antibody produced in mouse clone S159-5, purified immunoglobulin mouse, rat
immunohistochemistry, western blot pricing
SAB5201354 Monoclonal Anti-Protocadherin Gamma (Pan) - Rpe antibody produced in mouse clone S159-5, purified immunoglobulin mouse, rat
immunohistochemistry, western blot pricing
SAB5201355 Monoclonal Anti-Protocadherin Gamma (Pan) - Streptavidin antibody produced in mouse clone S159-5, purified immunoglobulin mouse, rat
immunohistochemistry, western blot pricing
SAB5201338 Monoclonal Anti-Protocadherin Gamma (Pan) antibody produced in mouse clone S159-5, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033584 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033584 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033584 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018912 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125981 MISSION® esiRNA esiRNA human PCDHGA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018912 Rosetta Predictions human pricing
NM_031993 Rosetta Predictions human pricing
NM_001037140 Rosetta Predictions rat pricing
NM_033584 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159680 predicted 477
2 SASI_Hs01_00159681 predicted 1083
3 SASI_Hs01_00159682 predicted 1458
4 SASI_Hs01_00159683 predicted 400
5 SASI_Hs01_00159684 predicted 1145
6 SASI_Hs01_00159685 predicted 1636
7 SASI_Hs01_00159686 predicted 857
8 SASI_Hs01_00159687 predicted 1237
9 SASI_Hs01_00159688 predicted 683
10 SASI_Hs01_00159689 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025009 predicted 480
2 SASI_Hs01_00025010 predicted 1083
3 SASI_Hs01_00025011 predicted 1462
4 SASI_Hs01_00025012 predicted 401
5 SASI_Hs01_00025013 predicted 1138
6 SASI_Hs01_00025014 predicted 1639
7 SASI_Hs01_00025015 predicted 858
8 SASI_Hs01_00025016 predicted 1233
9 SASI_Hs01_00025017 predicted 677
10 SASI_Hs01_00025018 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115014 predicted 2656
2 SASI_Rn01_00115013 predicted 1233
3 SASI_Rn01_00115015 predicted 1474
4 SASI_Rn01_00115016 predicted 321
5 SASI_Rn01_00115017 predicted 2099
6 SASI_Rn01_00115018 predicted 1190
7 SASI_Rn01_00115019 predicted 1611
8 SASI_Rn01_00115020 predicted 1534
9 SASI_Rn01_00115021 predicted 859
10 SASI_Rn02_00204236 predicted 1087
11 SASI_Rn01_00115022 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039268 predicted 2661
2 SASI_Mm01_00039269 predicted 1083
3 SASI_Mm01_00039270 predicted 1189
4 SASI_Mm01_00039271 predicted 983
5 SASI_Mm01_00039272 predicted 1572
6 SASI_Mm01_00039273 predicted 1613
7 SASI_Mm02_00337437 predicted 1474
8 SASI_Mm02_00337438 predicted 1674
9 SASI_Mm01_00039274 predicted 428
10 SASI_Mm01_00039275 predicted 760
11 SASI_Mm01_00039276 predicted 880
12 SASI_Mm01_00039277 predicted 2315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033584
PCDHGA1 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033584.1-721s1c1
Sequence:CCGGGCATTTACTAAGGCAGAGTATCTCGAGATACTCTGCCTTAGTAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033584.1-1192s1c1
Sequence:CCGGGTCGACAATTATTACCGCTTACTCGAGTAAGCGGTAATAATTGTCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033584.1-3548s1c1
Sequence:CCGGCCTCAAAGAAGAGACTCCTTTCTCGAGAAAGGAGTCTCTTCTTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033584.1-352s1c1
Sequence:CCGGCCTATCGAAGTAGAGATAATTCTCGAGAATTATCTCTACTTCGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033584.1-1125s1c1
Sequence:CCGGCGCTGATAACAACGGTCACATCTCGAGATGTGACCGTTGTTATCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033584
PCDHGA1 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033584.1-721s1c1
Sequence:CCGGGCATTTACTAAGGCAGAGTATCTCGAGATACTCTGCCTTAGTAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033584.1-1192s1c1
Sequence:CCGGGTCGACAATTATTACCGCTTACTCGAGTAAGCGGTAATAATTGTCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033584.1-3548s1c1
Sequence:CCGGCCTCAAAGAAGAGACTCCTTTCTCGAGAAAGGAGTCTCTTCTTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033584.1-352s1c1
Sequence:CCGGCCTATCGAAGTAGAGATAATTCTCGAGAATTATCTCTACTTCGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033584.1-1125s1c1
Sequence:CCGGCGCTGATAACAACGGTCACATCTCGAGATGTGACCGTTGTTATCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033584
PCDHGA1 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033584.1-721s1c1
Sequence:CCGGGCATTTACTAAGGCAGAGTATCTCGAGATACTCTGCCTTAGTAAATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033584.1-1192s1c1
Sequence:CCGGGTCGACAATTATTACCGCTTACTCGAGTAAGCGGTAATAATTGTCGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033584.1-3548s1c1
Sequence:CCGGCCTCAAAGAAGAGACTCCTTTCTCGAGAAAGGAGTCTCTTCTTTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033584.1-352s1c1
Sequence:CCGGCCTATCGAAGTAGAGATAATTCTCGAGAATTATCTCTACTTCGATAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033584.1-1125s1c1
Sequence:CCGGCGCTGATAACAACGGTCACATCTCGAGATGTGACCGTTGTTATCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018912
PCDHGA1 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018912.2-1456s1c1
Sequence:CCGGCAAATCACTTACTCCCTAATACTCGAGTATTAGGGAGTAAGTGATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018912.2-865s1c1
Sequence:CCGGGCCCAAATATTTCGTTTAGATCTCGAGATCTAAACGAAATATTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018912.2-2381s1c1
Sequence:CCGGCCCAGTCTTTACTTGAAGACACTCGAGTGTCTTCAAGTAAAGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018912.2-1159s1c1
Sequence:CCGGCCTGGAAATTTACCCTTTAAACTCGAGTTTAAAGGGTAAATTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018912.2-231s1c1
Sequence:CCGGGAATCCTAGAAGTGGCAGCTTCTCGAGAAGCTGCCACTTCTAGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018912
PCDHGA1 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018912.2-1456s1c1
Sequence:CCGGCAAATCACTTACTCCCTAATACTCGAGTATTAGGGAGTAAGTGATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018912.2-865s1c1
Sequence:CCGGGCCCAAATATTTCGTTTAGATCTCGAGATCTAAACGAAATATTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018912.2-2381s1c1
Sequence:CCGGCCCAGTCTTTACTTGAAGACACTCGAGTGTCTTCAAGTAAAGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018912.2-1159s1c1
Sequence:CCGGCCTGGAAATTTACCCTTTAAACTCGAGTTTAAAGGGTAAATTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018912.2-231s1c1
Sequence:CCGGGAATCCTAGAAGTGGCAGCTTCTCGAGAAGCTGCCACTTCTAGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018912
PCDHGA1 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018912.2-1456s1c1
Sequence:CCGGCAAATCACTTACTCCCTAATACTCGAGTATTAGGGAGTAAGTGATTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018912.2-865s1c1
Sequence:CCGGGCCCAAATATTTCGTTTAGATCTCGAGATCTAAACGAAATATTTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018912.2-2381s1c1
Sequence:CCGGCCCAGTCTTTACTTGAAGACACTCGAGTGTCTTCAAGTAAAGACTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018912.2-1159s1c1
Sequence:CCGGCCTGGAAATTTACCCTTTAAACTCGAGTTTAAAGGGTAAATTTCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018912.2-231s1c1
Sequence:CCGGGAATCCTAGAAGTGGCAGCTTCTCGAGAAGCTGCCACTTCTAGGATTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)